Transcript: Human XM_006712331.3

PREDICTED: Homo sapiens C2 calcium dependent domain containing 6 (C2CD6), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C2CD6 (151254)
Length:
2118
CDS:
53..1927

Additional Resources:

NCBI RefSeq record:
XM_006712331.3
NBCI Gene record:
C2CD6 (151254)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712331.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128530 CCGGATATCATGCACATTAAA pLKO.1 164 CDS 100% 15.000 21.000 N C2CD6 n/a
2 TRCN0000415846 GTTCGCTCATTTGTGATATTA pLKO_005 1933 3UTR 100% 15.000 21.000 N C2CD6 n/a
3 TRCN0000428523 TATACTGCTCCGGAGGTTAAC pLKO_005 1772 CDS 100% 10.800 15.120 N C2CD6 n/a
4 TRCN0000127667 CACCTTTAGGTGAACGTCAAT pLKO.1 1434 CDS 100% 4.950 3.465 N C2CD6 n/a
5 TRCN0000127570 CCAGACCTGAATGTTACTGTT pLKO.1 932 CDS 100% 4.950 3.465 N C2CD6 n/a
6 TRCN0000128393 GCCTAAGATCAGTTTACAACA pLKO.1 415 CDS 100% 4.950 3.465 N C2CD6 n/a
7 TRCN0000131188 GCTATTGCAGAGGAATCCCTA pLKO.1 136 CDS 100% 2.640 1.848 N C2CD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712331.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09680 pDONR223 100% 99.7% 99.6% None 291G>A;1128T>A;1161_1163delAGC n/a
2 ccsbBroad304_09680 pLX_304 0% 99.7% 99.6% V5 291G>A;1128T>A;1161_1163delAGC n/a
3 TRCN0000474510 GCCAGGTTCCAGAACCGCACGAGC pLX_317 30.1% 99.7% 99.6% V5 291G>A;1128T>A;1161_1163delAGC n/a
Download CSV