Transcript: Human XM_006712383.1

PREDICTED: Homo sapiens cytoplasmic linker associated protein 1 (CLASP1), transcript variant X25, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLASP1 (23332)
Length:
7811
CDS:
362..4726

Additional Resources:

NCBI RefSeq record:
XM_006712383.1
NBCI Gene record:
CLASP1 (23332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712383.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265397 TTGGGTGAACTCTAGCAATTA pLKO_005 532 CDS 100% 13.200 18.480 N Clasp1 n/a
2 TRCN0000113934 CCCTAGGTTAATACCTGTCAT pLKO.1 1687 CDS 100% 4.950 6.930 N CLASP1 n/a
3 TRCN0000113931 CCCTTTATTTATCAAGCGTAA pLKO.1 7419 3UTR 100% 4.050 5.670 N CLASP1 n/a
4 TRCN0000113935 CCAAGTCTAATAGACAGACTA pLKO.1 641 CDS 100% 0.495 0.693 N CLASP1 n/a
5 TRCN0000414231 GATCTGAATGAGCCAATTAAA pLKO_005 3704 CDS 100% 15.000 10.500 N CLASP1 n/a
6 TRCN0000265376 CCATTATGCCAACTATCTTTA pLKO_005 1587 CDS 100% 13.200 9.240 N Clasp1 n/a
7 TRCN0000113932 GCAGAGAGTAAATGCTCTAAA pLKO.1 1378 CDS 100% 13.200 9.240 N CLASP1 n/a
8 TRCN0000417514 GTTTGCTCTGAGCGCTCATAT pLKO_005 2726 CDS 100% 13.200 9.240 N CLASP1 n/a
9 TRCN0000113933 CCTGAATTTACCATGTTACTT pLKO.1 3392 CDS 100% 5.625 3.938 N CLASP1 n/a
10 TRCN0000216115 CAAGAACTGATAGACTATTTG pLKO.1 434 CDS 100% 13.200 18.480 N Rhobtb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712383.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11720 pDONR223 100% 10.2% 10.2% None 1_3915del n/a
2 ccsbBroad304_11720 pLX_304 0% 10.2% 10.2% V5 1_3915del n/a
3 TRCN0000474886 TTTTTTTCCCTTTGGCCTCGACAC pLX_317 89% 10.2% 10.2% V5 1_3915del n/a
Download CSV