Transcript: Human XM_006712480.3

PREDICTED: Homo sapiens ArfGAP with FG repeats 1 (AGFG1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGFG1 (3267)
Length:
4163
CDS:
254..1990

Additional Resources:

NCBI RefSeq record:
XM_006712480.3
NBCI Gene record:
AGFG1 (3267)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712480.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313154 GTCTAGTGGTTCGAGTAATTT pLKO_005 997 CDS 100% 15.000 21.000 N Agfg1 n/a
2 TRCN0000060225 GCTGCTGGAGTATCTAGTAAT pLKO.1 1901 CDS 100% 13.200 18.480 N AGFG1 n/a
3 TRCN0000110790 GCCTTTACCAAAGTGGCCTTA pLKO.1 2647 3UTR 100% 4.050 3.240 N Agfg1 n/a
4 TRCN0000060227 CCACCTCCAGTAATGCGTATA pLKO.1 1416 CDS 100% 10.800 7.560 N AGFG1 n/a
5 TRCN0000333060 CCACCTCCAGTAATGCGTATA pLKO_005 1416 CDS 100% 10.800 7.560 N AGFG1 n/a
6 TRCN0000060224 GCTGCATCAGTAAATGCTAAT pLKO.1 1076 CDS 100% 10.800 7.560 N AGFG1 n/a
7 TRCN0000333059 GCTGCATCAGTAAATGCTAAT pLKO_005 1076 CDS 100% 10.800 7.560 N AGFG1 n/a
8 TRCN0000060226 CCAGTCAGTCAAGTGCATCTT pLKO.1 1344 CDS 100% 4.950 3.465 N AGFG1 n/a
9 TRCN0000333126 CCAGTCAGTCAAGTGCATCTT pLKO_005 1344 CDS 100% 4.950 3.465 N AGFG1 n/a
10 TRCN0000060223 CCTGAGGTCAAACCACTGAAA pLKO.1 716 CDS 100% 4.950 3.465 N AGFG1 n/a
11 TRCN0000333058 CCTGAGGTCAAACCACTGAAA pLKO_005 716 CDS 100% 4.950 3.465 N AGFG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712480.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15453 pDONR223 0% 97.1% 97.2% None 270A>G;1378_1425del;1464A>G n/a
2 ccsbBroad304_15453 pLX_304 0% 97.1% 97.2% V5 270A>G;1378_1425del;1464A>G n/a
3 TRCN0000480322 AAACGCCAACCAAGTTGCGGTACA pLX_317 23.7% 97.1% 97.2% V5 270A>G;1378_1425del;1464A>G n/a
4 ccsbBroadEn_14670 pDONR223 95.3% 97.1% 97% None 98A>G;1378_1425del;1464A>G n/a
5 ccsbBroad304_14670 pLX_304 0% 97.1% 97% V5 98A>G;1378_1425del;1464A>G n/a
6 TRCN0000468166 TACGCAAAGCTATAGTTCATCTCT pLX_317 21.7% 97.1% 97% V5 98A>G;1378_1425del;1464A>G n/a
Download CSV