Transcript: Human XM_006712482.3

PREDICTED: Homo sapiens 5-hydroxytryptamine receptor 2B (HTR2B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HTR2B (3357)
Length:
2829
CDS:
1172..2542

Additional Resources:

NCBI RefSeq record:
XM_006712482.3
NBCI Gene record:
HTR2B (3357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014486 CCGATATATCACCTGCAATTA pLKO.1 2272 CDS 100% 13.200 10.560 N HTR2B n/a
2 TRCN0000358285 TGCCATTCCAGTCCCTATTAA pLKO_005 1654 CDS 100% 15.000 10.500 N HTR2B n/a
3 TRCN0000014483 GCAGTTGTCATCAAACATAAT pLKO.1 2551 3UTR 100% 13.200 9.240 N HTR2B n/a
4 TRCN0000368526 TATGTCCTGCCTGGTTATTTC pLKO_005 1476 CDS 100% 13.200 9.240 N HTR2B n/a
5 TRCN0000014484 GCCTGGTTATTTCTTGACGTT pLKO.1 1484 CDS 100% 2.640 1.848 N HTR2B n/a
6 TRCN0000014485 CCAGTCCCTATTAAAGGGATA pLKO.1 1661 CDS 100% 0.405 0.284 N HTR2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06418 pDONR223 100% 92.8% 92.7% None (many diffs) n/a
2 ccsbBroad304_06418 pLX_304 0% 92.8% 92.7% V5 (many diffs) n/a
3 TRCN0000466805 CCTCCAACTGCAGAATGATGGACA pLX_317 23.1% 92.8% 92.7% V5 (many diffs) n/a
4 TRCN0000488770 CGCGTCGATCAGTACTCTATTATA pLX_317 21.2% 92.7% 92.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489449 AGCAGTATTTACGCACTAGCTGCA pLX_317 26.6% 92.6% 92.5% V5 (many diffs) n/a
Download CSV