Transcript: Human XM_006713451.3

PREDICTED: Homo sapiens nuclear receptor subfamily 1 group D member 2 (NR1D2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NR1D2 (9975)
Length:
4782
CDS:
55..1401

Additional Resources:

NCBI RefSeq record:
XM_006713451.3
NBCI Gene record:
NR1D2 (9975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713451.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365706 GAATGGTGATCTCGCCAATAT pLKO_005 222 CDS 100% 13.200 18.480 N NR1D2 n/a
2 TRCN0000376665 TCGTGCACTAAGGACCTTAAT pLKO_005 1442 3UTR 100% 13.200 18.480 N NR1D2 n/a
3 TRCN0000022193 CGCCAATATTGAAGGCATCTT pLKO.1 234 CDS 100% 4.950 6.930 N NR1D2 n/a
4 TRCN0000365778 ATTACTACCACAAGACTATTT pLKO_005 1986 3UTR 100% 13.200 9.240 N NR1D2 n/a
5 TRCN0000365705 TTGCCAGATCTTCGATCTTTA pLKO_005 1515 3UTR 100% 13.200 9.240 N NR1D2 n/a
6 TRCN0000022190 CCAATGAGTAAGTCTCCATAT pLKO.1 1207 CDS 100% 10.800 7.560 N NR1D2 n/a
7 TRCN0000370922 GTGGAATTTGCAAAGCGTATT pLKO_005 1303 CDS 100% 10.800 7.560 N NR1D2 n/a
8 TRCN0000022191 CCAGTACAAGAAGTGCCTGAA pLKO.1 459 CDS 100% 4.050 2.835 N NR1D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713451.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11440 pDONR223 100% 89.4% 84.3% None (many diffs) n/a
2 ccsbBroad304_11440 pLX_304 0% 89.4% 84.3% V5 (many diffs) n/a
3 TRCN0000474337 CAAGAGCTACGATCTACTCCCCCA pLX_317 29.6% 89.4% 84.3% V5 (many diffs) n/a
4 TRCN0000488448 GACGTTCAGTGGAATCGCTATCCC pLX_317 18.2% 77.2% 76.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489584 CTCCCCAAGTGTGCGCTCTTCCGA pLX_317 18% 77% 76% V5 (many diffs) n/a
Download CSV