Transcript: Human XM_006713756.3

PREDICTED: Homo sapiens polyhomeotic homolog 3 (PHC3), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHC3 (80012)
Length:
12446
CDS:
19..2796

Additional Resources:

NCBI RefSeq record:
XM_006713756.3
NBCI Gene record:
PHC3 (80012)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415999 CGACATGCTGTACAGGTAATT pLKO_005 184 CDS 100% 13.200 18.480 N PHC3 n/a
2 TRCN0000140991 CATTGGGATCTCCACATCAAA pLKO.1 2910 3UTR 100% 5.625 7.875 N PHC3 n/a
3 TRCN0000143157 CAAGTCAGTCTCCTACTATAA pLKO.1 1013 CDS 100% 13.200 9.240 N PHC3 n/a
4 TRCN0000415622 GGAATCGTAAGCCTGATAATC pLKO_005 2318 CDS 100% 13.200 9.240 N Phc3 n/a
5 TRCN0000141101 CAGGAACATGAAGCCTTGATA pLKO.1 2797 CDS 100% 5.625 3.938 N PHC3 n/a
6 TRCN0000140887 GCCAGGATATCGCAGATGAAT pLKO.1 2645 CDS 100% 5.625 3.938 N PHC3 n/a
7 TRCN0000139508 CCACAGATCCTAACCCATGTT pLKO.1 1939 CDS 100% 4.950 3.465 N PHC3 n/a
8 TRCN0000139438 CCAGTGGAAGACCATCTACAT pLKO.1 365 CDS 100% 4.950 3.465 N PHC3 n/a
9 TRCN0000139200 CCTTGCAGTCTATGCAGTCTT pLKO.1 1346 CDS 100% 4.950 3.465 N PHC3 n/a
10 TRCN0000143103 CTGACATTTCTTCTACAGGTA pLKO.1 2933 3UTR 100% 2.640 1.848 N PHC3 n/a
11 TRCN0000140669 CAACAGCACTTGATGCTGCAT pLKO.1 271 CDS 100% 0.264 0.185 N PHC3 n/a
12 TRCN0000142970 CTCCACATCAAATACTGACAT pLKO.1 2919 3UTR 100% 4.950 2.970 N PHC3 n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 7746 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 7746 3UTR 100% 4.950 2.475 Y C19orf31 n/a
15 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 11063 3UTR 100% 4.950 2.475 Y LOC387873 n/a
16 TRCN0000441135 CACAGACTGTTGCGGTAAATC pLKO_005 1490 CDS 100% 13.200 9.240 N Phc3 n/a
17 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 7744 3UTR 100% 4.950 2.475 Y ERN2 n/a
18 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 7744 3UTR 100% 4.950 2.475 Y P3H4 n/a
19 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 7744 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15997 pDONR223 0% 14.1% 13.5% None (many diffs) n/a
2 ccsbBroad304_15997 pLX_304 0% 14.1% 13.5% V5 (many diffs) n/a
3 TRCN0000473121 TTTTTCCGCTAGGGCAAAAGAACA pLX_317 96% 14.1% 13.5% V5 (many diffs) n/a
Download CSV