Transcript: Human XM_006714849.3

PREDICTED: Homo sapiens family with sequence similarity 153 member A (FAM153A), transcript variant X24, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM153A (285596)
Length:
4655
CDS:
98..1030

Additional Resources:

NCBI RefSeq record:
XM_006714849.3
NBCI Gene record:
FAM153A (285596)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434339 CAGACACACTGGCCGAATTTC pLKO_005 513 CDS 100% 13.200 7.920 N FAM153A n/a
2 TRCN0000164978 GTGGTGGCTTATGCCTGTAAT pLKO.1 1191 3UTR 100% 13.200 6.600 Y C9orf139 n/a
3 TRCN0000269658 ACTACGGGAGCTCCACCTATA pLKO_005 151 CDS 100% 10.800 5.400 Y FAM153CP n/a
4 TRCN0000281704 ATTGGAAGACTCCACCATTAC pLKO_005 832 CDS 100% 10.800 5.400 Y FAM153CP n/a
5 TRCN0000269708 AGTACCAAGAGGCGATGAAGA pLKO_005 186 CDS 100% 4.950 2.475 Y FAM153CP n/a
6 TRCN0000148441 CAATTGGAAGACTCCACCATT pLKO.1 830 CDS 100% 4.950 2.475 Y FAM153A n/a
7 TRCN0000148152 GAAGATCATCTAGAGGAGTTT pLKO.1 329 CDS 100% 4.950 2.475 Y FAM153A n/a
8 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3411 3UTR 100% 4.950 2.475 Y n/a
9 TRCN0000147331 GTATGCTTTCCATCAGAAGAT pLKO.1 314 CDS 100% 4.950 2.475 Y FAM153A n/a
10 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 3481 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
11 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 3481 3UTR 100% 1.080 0.540 Y TNNI1 n/a
12 TRCN0000148967 GTCCTGAAATGTTGGGACATT pLKO.1 995 CDS 100% 0.495 0.248 Y FAM153A n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1203 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13393 pDONR223 100% 80.1% 77% None (many diffs) n/a
2 ccsbBroad304_13393 pLX_304 0% 80.1% 77% V5 (many diffs) n/a
3 TRCN0000473620 CCCACGGTAGCCCGTACTGAACAA pLX_317 56.9% 80.1% 77% V5 (many diffs) n/a
4 ccsbBroadEn_13732 pDONR223 100% 46.1% 45.8% None (many diffs) n/a
5 ccsbBroad304_13732 pLX_304 0% 46.1% 45.8% V5 (many diffs) n/a
6 TRCN0000492291 GCGTAGATGATAAGAAGTTGGTAC pLX_317 87.2% 46.1% 45.8% V5 (many diffs) n/a
7 ccsbBroadEn_05725 pDONR223 100% 36.4% 36.1% None (many diffs) n/a
8 ccsbBroad304_05725 pLX_304 0% 36.4% 36.1% V5 (many diffs) n/a
9 TRCN0000479395 GTAGGCACGAAATGGCCCTAATGA pLX_317 84.1% 36.4% 36.1% V5 (many diffs) n/a
Download CSV