Transcript: Human XM_006715374.3

PREDICTED: Homo sapiens estrogen receptor 1 (ESR1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ESR1 (2099)
Length:
6282
CDS:
371..1771

Additional Resources:

NCBI RefSeq record:
XM_006715374.3
NBCI Gene record:
ESR1 (2099)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338158 GTGTGCCTCAAATCTATTATT pLKO_005 1706 CDS 100% 15.000 12.000 N ESR1 n/a
2 TRCN0000003300 CTACAGGCCAAATTCAGATAA pLKO.1 817 CDS 100% 13.200 10.560 N ESR1 n/a
3 TRCN0000338156 CTACAGGCCAAATTCAGATAA pLKO_005 817 CDS 100% 13.200 10.560 N ESR1 n/a
4 TRCN0000350962 CAACCAGTGCACCATTGATAA pLKO_005 1042 CDS 100% 13.200 9.240 N ESR1 n/a
5 TRCN0000338159 CCCTCATCATGCACCACTTTA pLKO_005 2022 3UTR 100% 13.200 9.240 N ESR1 n/a
6 TRCN0000010774 GCAGGATTGTTGTGGCTACTA pLKO.1 3007 3UTR 100% 4.950 3.465 N ESR1 n/a
7 TRCN0000003301 CTCTACTTCATCGCATTCCTT pLKO.1 1902 3UTR 100% 3.000 2.100 N ESR1 n/a
8 TRCN0000003298 GCCCTACTACCTGGAGAACGA pLKO.1 754 CDS 100% 0.880 0.616 N ESR1 n/a
9 TRCN0000350963 ATGCTTCAGGCTACCATTATG pLKO_005 942 CDS 100% 13.200 7.920 N ESR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00517 pDONR223 100% 78.2% 76.8% None (many diffs) n/a
2 ccsbBroad304_00517 pLX_304 26.5% 78.2% 76.8% V5 (many diffs) n/a
3 TRCN0000481482 CTTTAGAGGTAACGCATGAACATC pLX_317 28.9% 78.2% 76.8% V5 (many diffs) n/a
4 TRCN0000489098 TCCCTCCACCTGTGGTATTTTTAG pLX_317 18% 77.9% 76.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489532 TCGTCCCGATAGTGAGTTAACGCC pLX_317 15.2% 77.5% 76% V5 (many diffs) n/a
Download CSV