Transcript: Human XM_006715951.2

PREDICTED: Homo sapiens replication initiator 1 (REPIN1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
REPIN1 (29803)
Length:
3126
CDS:
157..2028

Additional Resources:

NCBI RefSeq record:
XM_006715951.2
NBCI Gene record:
REPIN1 (29803)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715951.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329976 CTTGTCCCAAATGCGAGAGAC pLKO_005 761 CDS 100% 4.050 5.670 N REPIN1 n/a
2 TRCN0000369283 CAAGCCCAACTTGATCGCTCA pLKO_005 1065 CDS 100% 2.160 3.024 N REPIN1 n/a
3 TRCN0000017653 CGCTTTACCAATAAGCCCTAT pLKO.1 1138 CDS 100% 4.050 3.240 N REPIN1 n/a
4 TRCN0000017655 GAGACGCTTCTGGCGACGAAA pLKO.1 777 CDS 100% 1.650 1.320 N REPIN1 n/a
5 TRCN0000369282 CCTCCATCCTCTGGTATTAAC pLKO_005 2360 3UTR 100% 13.200 9.240 N REPIN1 n/a
6 TRCN0000329977 GCGGGAAGCGCTTTACCAATA pLKO_005 1130 CDS 100% 10.800 7.560 N REPIN1 n/a
7 TRCN0000369358 GGAAGAACTTCGGCAAGAAGA pLKO_005 1550 CDS 100% 4.950 3.465 N REPIN1 n/a
8 TRCN0000329978 CACCAGAAGAAGCACGATGTC pLKO_005 2005 CDS 100% 4.050 2.835 N REPIN1 n/a
9 TRCN0000017654 ACAGCAAGATTCACAAGCGAT pLKO.1 1253 CDS 100% 2.640 1.848 N REPIN1 n/a
10 TRCN0000017656 CAGCCAGAAGTCCAACCTCAT pLKO.1 1896 CDS 100% 4.050 2.430 N REPIN1 n/a
11 TRCN0000107779 GCGCATCCACACGGGCGAGAA pLKO.1 1842 CDS 100% 0.000 0.000 Y ZNF787 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715951.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08125 pDONR223 99.6% 91% 91% None 1_168del n/a
2 ccsbBroad304_08125 pLX_304 0% 91% 91% V5 1_168del n/a
3 TRCN0000470096 GCTTAGCTGTGCTACTGTAGGAAA pLX_317 24.1% 91% 91% V5 1_168del n/a
4 ccsbBroadEn_08124 pDONR223 100% 90.9% 90.8% None 1_168del;430C>T n/a
5 ccsbBroad304_08124 pLX_304 0% 90.9% 90.8% V5 1_168del;430C>T n/a
6 TRCN0000468180 TAGGAGACTCTCTCAGGTGGGAGA pLX_317 24.1% 90.9% 90.8% V5 1_168del;430C>T n/a
Download CSV