Transcript: Human XM_006716094.3

PREDICTED: Homo sapiens solute carrier family 4 member 2 (SLC4A2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC4A2 (6522)
Length:
2352
CDS:
257..2257

Additional Resources:

NCBI RefSeq record:
XM_006716094.3
NBCI Gene record:
SLC4A2 (6522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716094.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043861 GCAGATTCTTTCTGTACGCCA pLKO.1 290 CDS 100% 0.660 0.528 N SLC4A2 n/a
2 TRCN0000043859 GCCCAAATCTGCCCAAGATAA pLKO.1 2209 CDS 100% 13.200 9.240 N SLC4A2 n/a
3 TRCN0000300677 GCCCAAATCTGCCCAAGATAA pLKO_005 2209 CDS 100% 13.200 9.240 N SLC4A2 n/a
4 TRCN0000043860 GCTCGCTGGATCAAATTTGAA pLKO.1 1286 CDS 100% 5.625 3.938 N SLC4A2 n/a
5 TRCN0000300612 GCTCGCTGGATCAAATTTGAA pLKO_005 1286 CDS 100% 5.625 3.938 N SLC4A2 n/a
6 TRCN0000043862 CGGCACTTGGTGCGGAAGAAT pLKO.1 1112 CDS 100% 1.875 1.313 N SLC4A2 n/a
7 TRCN0000310644 CGGCACTTGGTGCGGAAGAAT pLKO_005 1112 CDS 100% 1.875 1.313 N SLC4A2 n/a
8 TRCN0000165589 GAGGAAGATGAGGATGAGGTT pLKO.1 629 CDS 100% 2.640 1.320 Y GPIHBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716094.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13954 pDONR223 100% 47% 46.4% None (many diffs) n/a
2 ccsbBroad304_13954 pLX_304 0% 47% 46.4% V5 (many diffs) n/a
3 TRCN0000478220 ACCCCAAGGGTATTCATAAGTGTC pLX_317 7.2% 47% 46.4% V5 (many diffs) n/a
4 ccsbBroadEn_15593 pDONR223 0% 41.2% 39.1% None (many diffs) n/a
5 ccsbBroad304_15593 pLX_304 0% 41.2% 39.1% V5 (many diffs) n/a
Download CSV