Transcript: Human XM_006716686.4

PREDICTED: Homo sapiens transmembrane protein 67 (TMEM67), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM67 (91147)
Length:
4112
CDS:
213..2897

Additional Resources:

NCBI RefSeq record:
XM_006716686.4
NBCI Gene record:
TMEM67 (91147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716686.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364986 ATTCGACAGTTCGTTGATTTA pLKO_005 2196 CDS 100% 13.200 18.480 N TMEM67 n/a
2 TRCN0000364926 TCCCATTGTGTGTAGTATTTA pLKO_005 3084 3UTR 100% 15.000 10.500 N TMEM67 n/a
3 TRCN0000364927 TGACTTTCCCACTCCTATATT pLKO_005 1070 CDS 100% 15.000 10.500 N TMEM67 n/a
4 TRCN0000369943 TTCGAGTTGCTACTCAAATAT pLKO_005 1294 CDS 100% 15.000 10.500 N TMEM67 n/a
5 TRCN0000128198 CAAGGCTAAATGCTGCTTATT pLKO.1 994 CDS 100% 13.200 9.240 N TMEM67 n/a
6 TRCN0000150205 GTGCCTGTGTTAAACCTAAAT pLKO.1 1146 CDS 100% 13.200 9.240 N TMEM67 n/a
7 TRCN0000369902 TTACAATGATGAAGGTTATTC pLKO_005 2666 CDS 100% 13.200 9.240 N TMEM67 n/a
8 TRCN0000364925 TTGATGCATGTGGACTATTTC pLKO_005 703 CDS 100% 13.200 9.240 N TMEM67 n/a
9 TRCN0000376511 GCGACAACAACCAGTACTTTG pLKO_005 144 5UTR 100% 10.800 7.560 N TMEM67 n/a
10 TRCN0000147733 GTTGGGTATATGCCAATCTAA pLKO.1 619 CDS 100% 5.625 3.938 N TMEM67 n/a
11 TRCN0000146799 CCATCATTTGTCTCTGTAGAT pLKO.1 3201 3UTR 100% 4.950 3.465 N TMEM67 n/a
12 TRCN0000129134 GTCGTGTTCTTTGCTGTCTTT pLKO.1 2151 CDS 100% 4.950 3.465 N TMEM67 n/a
13 TRCN0000147047 CTCAGTATAATCATGGCCAAA pLKO.1 2922 3UTR 100% 4.050 2.835 N TMEM67 n/a
14 TRCN0000128427 GCATGTTCAGAACCTAACATT pLKO.1 462 CDS 100% 0.563 0.394 N TMEM67 n/a
15 TRCN0000369904 TTCCTATCTCTAAGATCTTAA pLKO_005 1048 CDS 100% 13.200 7.920 N TMEM67 n/a
16 TRCN0000148737 CTGCCTGAATCTTCTCACATT pLKO.1 3240 3UTR 100% 4.950 2.970 N TMEM67 n/a
17 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3714 3UTR 100% 4.950 2.475 Y ERAP2 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3715 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716686.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12955 pDONR223 100% 90.7% 90.6% None 1_1delAins267;6_7insA;8_9insAAACAT n/a
2 ccsbBroad304_12955 pLX_304 0% 90.7% 90.6% V5 1_1delAins267;6_7insA;8_9insAAACAT n/a
3 TRCN0000468342 AAGCGGATAATGTGGCTTCTCGGT pLX_317 3.3% 90.7% 90.6% V5 1_1delAins267;6_7insA;8_9insAAACAT n/a
Download CSV