Transcript: Human XM_006717291.3

PREDICTED: Homo sapiens bromodomain containing 3 (BRD3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRD3 (8019)
Length:
3242
CDS:
321..2501

Additional Resources:

NCBI RefSeq record:
XM_006717291.3
NBCI Gene record:
BRD3 (8019)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147217 GATGCTATCCAAGAAGCACG pXPR_003 CGG 979 45% 6 0.7207 BRD3 BRD3 76094
2 BRDN0001149039 TGAAGGTACACAGCAAGTGG pXPR_003 CGG 511 23% 5 0.6041 BRD3 BRD3 76093
3 BRDN0001148860 ATACAATCCCCCAGACCACG pXPR_003 AGG 1183 54% 7 0.3473 BRD3 BRD3 76095
4 BRDN0001146442 CATCACTGCAAACGTCACGT pXPR_003 CGG 625 29% 5 -0.0178 BRD3 BRD3 76092
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021378 GAGATATGTCAAGTCTTGTTT pLKO.1 2210 CDS 100% 5.625 7.875 N BRD3 n/a
2 TRCN0000199455 GTGAGATTCGTACCGAAGAAC pLKO.1 2791 3UTR 100% 4.950 6.930 N BRD3 n/a
3 TRCN0000196574 GTGGTTCATATTACTACTTCT pLKO.1 2566 3UTR 100% 4.950 6.930 N BRD3 n/a
4 TRCN0000199822 GCGTTAGACTTGATGAGAAGG pLKO.1 2676 3UTR 100% 4.050 5.670 N BRD3 n/a
5 TRCN0000195541 CAAATTGAACCTGCCGGATTA pLKO.1 518 CDS 100% 10.800 8.640 N BRD3 n/a
6 TRCN0000021376 GCTGATGTTCTCGAATTGCTA pLKO.1 1463 CDS 100% 3.000 2.400 N BRD3 n/a
7 TRCN0000021375 CCCAAGAGGAAGTTGAATTAT pLKO.1 742 CDS 100% 15.000 10.500 N BRD3 n/a
8 TRCN0000021374 CCAAGGAAATGTCTCGGATAT pLKO.1 2870 3UTR 100% 10.800 7.560 N BRD3 n/a
9 TRCN0000021377 CCCACAGATGACATAGTGCTA pLKO.1 672 CDS 100% 2.640 1.848 N BRD3 n/a
10 TRCN0000199036 CCCACCACTTTGCGGGAACTG pLKO.1 2187 CDS 100% 0.000 0.000 N BRD3 n/a
11 TRCN0000140823 GAAGGAGAAGAAGGAGAAGGT pLKO.1 1793 CDS 100% 2.640 1.320 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11251 pDONR223 100% 75.2% 75.5% None (many diffs) n/a
2 ccsbBroad304_11251 pLX_304 0% 75.2% 75.5% V5 (many diffs) n/a
3 TRCN0000478055 CGGTGGTTACGTATCGCTACCCCC pLX_317 19.6% 75.2% 75.5% V5 (many diffs) n/a
4 ccsbBroadEn_14888 pDONR223 93.2% 74.9% 33% None (many diffs) n/a
5 ccsbBroad304_14888 pLX_304 0% 74.9% 33% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000473067 TGACGGGCAGCCGACGCTAGCAGT pLX_317 19.6% 74.9% 33% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV