Transcript: Human XM_006717300.2

PREDICTED: Homo sapiens phosphatidylinositol-4-phosphate 5-kinase type 1 beta (PIP5K1B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIP5K1B (8395)
Length:
2847
CDS:
498..2120

Additional Resources:

NCBI RefSeq record:
XM_006717300.2
NBCI Gene record:
PIP5K1B (8395)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717300.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230745 TCTGTGCTTGACGTCTATTTA pLKO_005 2097 CDS 100% 15.000 21.000 N PIP5K1B n/a
2 TRCN0000359201 ACATGCACGAAGGGTTGTATT pLKO_005 1195 CDS 100% 13.200 18.480 N PIP5K1B n/a
3 TRCN0000230744 ACGACAGGCCTACACTCTATT pLKO_005 1972 CDS 100% 13.200 18.480 N PIP5K1B n/a
4 TRCN0000230742 CCATTAGCATTCCGATATTTC pLKO_005 759 CDS 100% 13.200 18.480 N PIP5K1B n/a
5 TRCN0000359135 TACTACCCTATTCTATCATTT pLKO_005 2308 3UTR 100% 13.200 18.480 N PIP5K1B n/a
6 TRCN0000037860 CGTCTAAGAAACGGTGCAATT pLKO.1 1714 CDS 100% 10.800 15.120 N PIP5K1B n/a
7 TRCN0000037862 CGGAAACATACAACGCGCTTA pLKO.1 1222 CDS 100% 4.050 5.670 N PIP5K1B n/a
8 TRCN0000230743 ATGCAATCAGGAGGCATTAAT pLKO_005 1023 CDS 100% 15.000 12.000 N PIP5K1B n/a
9 TRCN0000218779 CATCCACACACATGGTAAATT pLKO_005 2517 3UTR 100% 15.000 10.500 N PIP5K1B n/a
10 TRCN0000037859 CCAGGCTATTACATGAATTTA pLKO.1 954 CDS 100% 15.000 10.500 N PIP5K1B n/a
11 TRCN0000359136 CATCTGCAGTGAACCTCTAAT pLKO_005 821 CDS 100% 13.200 9.240 N PIP5K1B n/a
12 TRCN0000197135 GCTGACTGAAGGACAAAGTTT pLKO.1 1814 CDS 100% 5.625 3.938 N PIP5K1B n/a
13 TRCN0000037861 CGCTCCATTAGCATTCCGATA pLKO.1 755 CDS 100% 4.050 2.835 N PIP5K1B n/a
14 TRCN0000196843 GCAACATATGTAATCTGCTTA pLKO.1 2480 3UTR 100% 0.000 0.000 N PIP5K1B n/a
15 TRCN0000037863 GCACATCACTACCCAGACTTT pLKO.1 720 CDS 100% 4.950 2.970 N PIP5K1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717300.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489361 AACGGTACGTTGGGCACGTCACCT pLX_317 23.3% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_11269 pDONR223 100% 87.2% 86.2% None (many diffs) n/a
3 ccsbBroad304_11269 pLX_304 0% 87.2% 86.2% V5 (many diffs) n/a
4 ccsbBroadEn_14892 pDONR223 0% 87.2% 86.2% None (many diffs) n/a
5 ccsbBroad304_14892 pLX_304 0% 87.2% 86.2% V5 (many diffs) n/a
6 TRCN0000474001 GACGGGCAACATTTCGGGGGATCA pLX_317 28.7% 87.2% 86.2% V5 (many diffs) n/a
Download CSV