Transcript: Human XM_006718647.4

PREDICTED: Homo sapiens RAB3A interacting protein like 1 (RAB3IL1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB3IL1 (5866)
Length:
2335
CDS:
70..1356

Additional Resources:

NCBI RefSeq record:
XM_006718647.4
NBCI Gene record:
RAB3IL1 (5866)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718647.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140552 GCCATTACTACATCTCGCCAT pLKO.1 1175 CDS 100% 2.160 3.024 N RAB3IL1 n/a
2 TRCN0000141657 CATTACTACATCTCGCCATCT pLKO.1 1177 CDS 100% 4.050 3.240 N RAB3IL1 n/a
3 TRCN0000140658 CCTGTTTGAGGAAGCTCACAA pLKO.1 561 CDS 100% 4.950 3.465 N RAB3IL1 n/a
4 TRCN0000144359 CCTTGTTAAGATGAGTCAAGA pLKO.1 1913 3UTR 100% 4.950 3.465 N RAB3IL1 n/a
5 TRCN0000140631 GAGGAAGCTCACAAGATGGTT pLKO.1 568 CDS 100% 3.000 2.100 N RAB3IL1 n/a
6 TRCN0000139880 GCTAAAGGACGAGGAATGTGA pLKO.1 483 CDS 100% 3.000 2.100 N RAB3IL1 n/a
7 TRCN0000140933 CTGAAGCTAAAGGACGAGGAA pLKO.1 478 CDS 100% 2.640 1.848 N RAB3IL1 n/a
8 TRCN0000140875 GTTCTGGGAGATCATGAGGTT pLKO.1 1284 CDS 100% 2.640 1.848 N RAB3IL1 n/a
9 TRCN0000140361 GCTTGTCTTCAGAAAGGGACT pLKO.1 1730 3UTR 100% 2.160 1.512 N RAB3IL1 n/a
10 TRCN0000141192 CACAATCCTGTTTGCAGAGTT pLKO.1 873 CDS 100% 4.950 2.970 N RAB3IL1 n/a
11 TRCN0000139844 CTTCACCTACATCCGCTACAT pLKO.1 1230 CDS 100% 4.950 2.970 N RAB3IL1 n/a
12 TRCN0000142496 GTGCAACTTCTTCACCTACAT pLKO.1 1221 CDS 100% 4.950 2.970 N RAB3IL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718647.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01359 pDONR223 100% 88.5% 88.1% None (many diffs) n/a
2 ccsbBroad304_01359 pLX_304 0% 88.5% 88.1% V5 (many diffs) n/a
3 TRCN0000475494 CCCCTAGTCAGCCACCACAGAATC pLX_317 43.6% 88.4% 57% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15558 pDONR223 0% 82.7% 82.7% None 578_796del;1206_1207insGCA n/a
5 ccsbBroad304_15558 pLX_304 0% 82.7% 82.7% V5 578_796del;1206_1207insGCA n/a
Download CSV