Transcript: Human XM_006720158.3

PREDICTED: Homo sapiens phosphoenolpyruvate carboxykinase 2, mitochondrial (PCK2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCK2 (5106)
Length:
1847
CDS:
96..1589

Additional Resources:

NCBI RefSeq record:
XM_006720158.3
NBCI Gene record:
PCK2 (5106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145524 GCTGAATGGAAGCACATACA pXPR_003 TGG 472 32% 4 1.1031 PCK2 PCK2 78081
2 BRDN0001487084 GGCACGAGTAGAGAGCAAGA pXPR_003 CGG 322 22% 3 1.0972 PCK2 PCK2 78082
3 BRDN0001145460 TGCGTATTATGACCCGACTG pXPR_003 GGG 579 39% 4 0.2195 PCK2 PCK2 78080
4 BRDN0001146925 ACAAAATCTCGAATGCCAGT pXPR_003 GGG 126 8% 2 -0.1223 PCK2 PCK2 78083
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720158.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195705 CCATTGACGCCATCATCTTTG pLKO.1 1429 CDS 100% 10.800 15.120 N PCK2 n/a
2 TRCN0000199662 GTTCGTGACATTCGGAGCTAC pLKO.1 1582 CDS 100% 4.050 5.670 N PCK2 n/a
3 TRCN0000312598 GGTGGCAAGCATGCGTATTAT pLKO_005 647 CDS 100% 15.000 12.000 N PCK2 n/a
4 TRCN0000052667 GAACAGGAGGTTCGTGACATT pLKO.1 1573 CDS 100% 4.950 3.960 N PCK2 n/a
5 TRCN0000380418 ACAATCCAGAGTAACACTATT pLKO_005 1197 CDS 100% 13.200 9.240 N PCK2 n/a
6 TRCN0000381527 TCCCACTGGCATTCGAGATTT pLKO_005 215 CDS 100% 13.200 9.240 N PCK2 n/a
7 TRCN0000370248 CTGCTGCAGCAGAACACAAAG pLKO_005 1543 CDS 100% 10.800 7.560 N PCK2 n/a
8 TRCN0000052664 GCACATCCCAACTCTCGATTT pLKO.1 1347 CDS 100% 10.800 7.560 N PCK2 n/a
9 TRCN0000327658 GCACATCCCAACTCTCGATTT pLKO_005 1347 CDS 100% 10.800 7.560 N PCK2 n/a
10 TRCN0000052665 CATGGCTACAATCCAGAGTAA pLKO.1 1190 CDS 100% 4.950 3.465 N PCK2 n/a
11 TRCN0000052666 GTAGAGAGCAAGACGGTGATT pLKO.1 408 CDS 100% 4.950 3.465 N PCK2 n/a
12 TRCN0000327657 GTAGAGAGCAAGACGGTGATT pLKO_005 408 CDS 100% 4.950 3.465 N PCK2 n/a
13 TRCN0000052663 GCACCATGTATGTGCTTCCAT pLKO.1 559 CDS 100% 3.000 2.100 N PCK2 n/a
14 TRCN0000088646 AGACGGTGATTGTAACTCCTT pLKO.1 418 CDS 100% 2.640 1.848 N Pck2 n/a
15 TRCN0000334129 AGACGGTGATTGTAACTCCTT pLKO_005 418 CDS 100% 2.640 1.848 N Pck2 n/a
16 TRCN0000312597 CTAGTCTAGCAAGAGGACATA pLKO_005 1696 3UTR 100% 0.000 0.000 N PCK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720158.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06695 pDONR223 100% 77.4% 76.5% None (many diffs) n/a
2 ccsbBroad304_06695 pLX_304 0% 77.4% 76.5% V5 (many diffs) n/a
3 TRCN0000474518 ATCTCACTTGAACCCTGTGTCAAT pLX_317 23.1% 77.4% 76.5% V5 (many diffs) n/a
4 ccsbBroadEn_14729 pDONR223 0% 77.4% 76.5% None (many diffs) n/a
5 ccsbBroad304_14729 pLX_304 0% 77.4% 76.5% V5 (many diffs) n/a
6 TRCN0000469728 ATTCGTGTTTCAAGTAAGTGGTAG pLX_317 17.8% 77.4% 76.5% V5 (many diffs) n/a
7 TRCN0000488002 GCACTAATTCCGCCGAGACGGGCG pLX_317 8.9% 77.4% 76.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV