Transcript: Human XM_006720174.3

PREDICTED: Homo sapiens kelch like family member 28 (KLHL28), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHL28 (54813)
Length:
1719
CDS:
653..1651

Additional Resources:

NCBI RefSeq record:
XM_006720174.3
NBCI Gene record:
KLHL28 (54813)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720174.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142103 GCTATGTTCACTGGAAACCTT pLKO.1 878 CDS 100% 3.000 2.400 N KLHL28 n/a
2 TRCN0000141219 CAGCCCGTATTTCAAAGCTAT pLKO.1 862 CDS 100% 4.950 3.465 N KLHL28 n/a
3 TRCN0000179309 GCTTGCTAACTTAACCCACTT pLKO.1 721 CDS 100% 4.050 2.835 N Klhl28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720174.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15871 pDONR223 0% 58.6% 57.8% None (many diffs) n/a
2 ccsbBroad304_15871 pLX_304 0% 58.6% 57.8% V5 (many diffs) n/a
3 ccsbBroadEn_03462 pDONR223 100% 52.4% 51.6% None (many diffs) n/a
4 ccsbBroad304_03462 pLX_304 0% 52.4% 51.6% V5 (many diffs) n/a
5 TRCN0000466093 ACATGTGCGCCCTATACTCCACAG pLX_317 22.9% 52.4% 51.6% V5 (many diffs) n/a
Download CSV