Transcript: Human XM_006720257.3

PREDICTED: Homo sapiens zinc finger CCCH-type containing 14 (ZC3H14), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZC3H14 (79882)
Length:
1692
CDS:
314..1555

Additional Resources:

NCBI RefSeq record:
XM_006720257.3
NBCI Gene record:
ZC3H14 (79882)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720257.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129229 CCATGCAGACACAAGATCATT pLKO.1 724 CDS 100% 5.625 3.938 N ZC3H14 n/a
2 TRCN0000343635 CCATGCAGACACAAGATCATT pLKO_005 724 CDS 100% 5.625 3.938 N ZC3H14 n/a
3 TRCN0000128105 CCGTTACTTCCCTGCTTGTAA pLKO.1 1390 CDS 100% 5.625 3.938 N ZC3H14 n/a
4 TRCN0000343697 CCGTTACTTCCCTGCTTGTAA pLKO_005 1390 CDS 100% 5.625 3.938 N ZC3H14 n/a
5 TRCN0000128765 CCAGGATACATGTCAGATCAA pLKO.1 929 CDS 100% 4.950 3.465 N ZC3H14 n/a
6 TRCN0000173125 CACCTTATGCAGACACGAGAT pLKO.1 842 CDS 100% 4.050 2.835 N Zc3h14 n/a
7 TRCN0000341193 CACCTTATGCAGACACGAGAT pLKO_005 842 CDS 100% 4.050 2.835 N Zc3h14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720257.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04145 pDONR223 100% 72.9% 69.5% None (many diffs) n/a
2 ccsbBroad304_04145 pLX_304 0% 72.9% 69.5% V5 (many diffs) n/a
3 TRCN0000470306 CTTTCGGACTTCGTTGACTCCACG pLX_317 55.1% 72.9% 69.5% V5 (many diffs) n/a
Download CSV