Transcript: Human XM_006723829.3

PREDICTED: Homo sapiens sulfatase 2 (SULF2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SULF2 (55959)
Length:
3892
CDS:
321..2936

Additional Resources:

NCBI RefSeq record:
XM_006723829.3
NBCI Gene record:
SULF2 (55959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723829.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364454 CCCACATCGTCCTCAACATTG pLKO_005 1390 CDS 100% 10.800 15.120 N SULF2 n/a
2 TRCN0000051983 CGAGAGAGATTTCCTTGGAAA pLKO.1 3253 3UTR 100% 4.950 6.930 N SULF2 n/a
3 TRCN0000051984 CAAGGGTTACAAGCAGTGTAA pLKO.1 2771 CDS 100% 0.495 0.693 N SULF2 n/a
4 TRCN0000377275 CATCAATGAGACTCACAATTT pLKO_005 2609 CDS 100% 13.200 9.240 N SULF2 n/a
5 TRCN0000364518 GGGCGAAAGTCATTGGAATTT pLKO_005 3284 3UTR 100% 13.200 9.240 N SULF2 n/a
6 TRCN0000369075 TTTCTTCGGGAAGTATCTTAA pLKO_005 737 CDS 100% 13.200 9.240 N SULF2 n/a
7 TRCN0000376485 ACGACTCCATGGAGACGATTT pLKO_005 1192 CDS 100% 10.800 7.560 N SULF2 n/a
8 TRCN0000364517 GGACAACACGTACATCGTATA pLKO_005 1241 CDS 100% 10.800 7.560 N SULF2 n/a
9 TRCN0000369076 TGCACATCGACCACGAGATTG pLKO_005 2209 CDS 100% 10.800 7.560 N SULF2 n/a
10 TRCN0000376409 TGCGGATATGGACGGGAAATC pLKO_005 1454 CDS 100% 10.800 7.560 N SULF2 n/a
11 TRCN0000051986 CCACAACACCTACACCAACAA pLKO.1 629 CDS 100% 4.950 3.465 N SULF2 n/a
12 TRCN0000051985 CCTGGTGAAAGGGAAATCCAT pLKO.1 1298 CDS 100% 3.000 2.100 N SULF2 n/a
13 TRCN0000051987 GCCTGGACATACCTGCGGATA pLKO.1 1441 CDS 100% 1.350 0.945 N SULF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723829.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03686 pDONR223 100% 99.8% 99.8% None 1805_1807delGCA n/a
2 ccsbBroad304_03686 pLX_304 0% 99.8% 99.8% V5 1805_1807delGCA n/a
3 TRCN0000467260 CAGACTTTGACATACCAAACCATC pLX_317 16.4% 99.8% 99.7% V5 1805_1807delGCA;2201A>G n/a
4 TRCN0000488599 CCAAATTTATCCGAGAAATGGTGT pLX_317 12.1% 99.5% 99.8% V5 (not translated due to prior stop codon) 291T>C;1805_1807delGCA;2613_2614insTAAAAGCT n/a
5 TRCN0000489588 ATCCCTCAGCTGGGAGTTGTGTCC pLX_317 15.2% 97.6% 97.5% V5 (many diffs) n/a
6 TRCN0000487852 TTCTTAGCTTGATTTAGTGCCCTA pLX_317 12.8% 97.4% 97.7% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_12292 pDONR223 100% 17.1% 17.1% None 1_2166del n/a
8 ccsbBroad304_12292 pLX_304 0% 17.1% 17.1% V5 1_2166del n/a
9 TRCN0000473719 ACACTCACATTATGGGGCCACTAC pLX_317 77.7% 17.1% 17.1% V5 1_2166del n/a
Download CSV