Transcript: Human XM_006724189.3

PREDICTED: Homo sapiens RNA binding fox-1 homolog 2 (RBFOX2), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBFOX2 (23543)
Length:
7017
CDS:
305..1558

Additional Resources:

NCBI RefSeq record:
XM_006724189.3
NBCI Gene record:
RBFOX2 (23543)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294132 AGACATTAGGAGCCGATAAAT pLKO_005 1900 3UTR 100% 15.000 21.000 N RBFOX2 n/a
2 TRCN0000294044 GTATATGGTCCGGAGTTATAT pLKO_005 1007 CDS 100% 15.000 21.000 N RBFOX2 n/a
3 TRCN0000306861 TTGGCGCTGTGGCGAGTTTAT pLKO_005 1493 CDS 100% 13.200 18.480 N RBFOX2 n/a
4 TRCN0000294042 GCCGCTTACAGTGACGGTTAT pLKO_005 1414 CDS 100% 10.800 15.120 N RBFOX2 n/a
5 TRCN0000074544 CGGGTTCGTAACTTTCGAGAA pLKO.1 829 CDS 100% 4.050 5.670 N RBFOX2 n/a
6 TRCN0000311693 CGGGTTCGTAACTTTCGAGAA pLKO_005 829 CDS 100% 4.050 5.670 N RBFOX2 n/a
7 TRCN0000074545 GCATCCAGCTTTCAAGCAGAT pLKO.1 1031 CDS 100% 4.050 2.835 N RBFOX2 n/a
8 TRCN0000074546 CATATGCAAATGGTTGGAAAT pLKO.1 966 CDS 100% 0.000 0.000 N RBFOX2 n/a
9 TRCN0000074547 CCATATGCAAATGGTTGGAAA pLKO.1 965 CDS 100% 0.000 0.000 N RBFOX2 n/a
10 TRCN0000074543 CCTCACTATGTTCTTTGAATA pLKO.1 1705 3UTR 100% 13.200 7.920 N RBFOX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02790 pDONR223 100% 90.3% 72.1% None (many diffs) n/a
2 ccsbBroad304_02790 pLX_304 0% 90.3% 72.1% V5 (many diffs) n/a
3 ccsbBroadEn_11745 pDONR223 100% 84.9% 66.9% None (many diffs) n/a
4 ccsbBroad304_11745 pLX_304 0% 84.9% 66.9% V5 (many diffs) n/a
5 TRCN0000478244 AAGGTTCGACCCGCACGGCTGATA pLX_317 24.7% 84.9% 66.9% V5 (many diffs) n/a
Download CSV