Transcript: Mouse XM_011238337.2

PREDICTED: Mus musculus ATPase, H+ transporting, lysosomal V1 subunit H (Atp6v1h), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp6v1h (108664)
Length:
2077
CDS:
199..1029

Additional Resources:

NCBI RefSeq record:
XM_011238337.2
NBCI Gene record:
Atp6v1h (108664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238337.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101453 CTGGCTATGATTCAATGCAAA pLKO.1 496 CDS 100% 4.950 6.930 N Atp6v1h n/a
2 TRCN0000327355 CTGGCTATGATTCAATGCAAA pLKO_005 496 CDS 100% 4.950 6.930 N Atp6v1h n/a
3 TRCN0000101451 CGCTATAATATCATTCCTGTT pLKO.1 361 CDS 100% 4.050 5.670 N Atp6v1h n/a
4 TRCN0000363615 CGCTATAATATCATTCCTGTT pLKO_005 361 CDS 100% 4.050 5.670 N Atp6v1h n/a
5 TRCN0000101454 CCTTAGCTCATTTGATGAATA pLKO.1 621 CDS 100% 13.200 9.240 N Atp6v1h n/a
6 TRCN0000327429 CCTTAGCTCATTTGATGAATA pLKO_005 621 CDS 100% 13.200 9.240 N Atp6v1h n/a
7 TRCN0000043044 GCTCACGATGTTGGAGAATAT pLKO.1 808 CDS 100% 13.200 9.240 N ATP6V1H n/a
8 TRCN0000289794 GCTCACGATGTTGGAGAATAT pLKO_005 808 CDS 100% 13.200 9.240 N ATP6V1H n/a
9 TRCN0000043043 CCTGGCATTCAGTCCTCAAAT pLKO.1 324 CDS 100% 13.200 7.920 N ATP6V1H n/a
10 TRCN0000101450 CTATGGTAATTCCTGGGAGAA pLKO.1 1153 3UTR 100% 4.050 2.430 N Atp6v1h n/a
11 TRCN0000327354 CTATGGTAATTCCTGGGAGAA pLKO_005 1153 3UTR 100% 4.050 2.430 N Atp6v1h n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238337.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03343 pDONR223 100% 51.8% 57.1% None (many diffs) n/a
2 ccsbBroad304_03343 pLX_304 0% 51.8% 57.1% V5 (many diffs) n/a
Download CSV