Transcript: Mouse XM_011238599.2

PREDICTED: Mus musculus GULP, engulfment adaptor PTB domain containing 1 (Gulp1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gulp1 (70676)
Length:
2881
CDS:
126..1064

Additional Resources:

NCBI RefSeq record:
XM_011238599.2
NBCI Gene record:
Gulp1 (70676)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101261 CCAGCTTCATAGAATATCATT pLKO.1 404 CDS 100% 5.625 7.875 N Gulp1 n/a
2 TRCN0000101262 GCCAGCTTCATAGAATATCAT pLKO.1 403 CDS 100% 5.625 7.875 N Gulp1 n/a
3 TRCN0000453934 ACCTAAAGCTTAGCTATTATG pLKO_005 1538 3UTR 100% 13.200 10.560 N Gulp1 n/a
4 TRCN0000443029 CCTTGACATTTATGCTCATTC pLKO_005 1351 3UTR 100% 10.800 8.640 N Gulp1 n/a
5 TRCN0000445519 AGAGGATATTCACTTTCATAT pLKO_005 448 CDS 100% 13.200 9.240 N Gulp1 n/a
6 TRCN0000029058 GCAAAGATTCTGAGTCAAATA pLKO.1 469 CDS 100% 13.200 9.240 N GULP1 n/a
7 TRCN0000101260 GCTCTGTTAAAGTCAGAATTT pLKO.1 2008 3UTR 100% 13.200 9.240 N Gulp1 n/a
8 TRCN0000101264 CTCCTGATATTCAGTCCAAAT pLKO.1 958 CDS 100% 10.800 7.560 N Gulp1 n/a
9 TRCN0000454150 CTGATATCTTTGACATGATTC pLKO_005 790 CDS 100% 10.800 7.560 N Gulp1 n/a
10 TRCN0000101263 CCTCCTGATATTCAGTCCAAA pLKO.1 957 CDS 100% 4.950 2.970 N Gulp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11988 pDONR223 100% 44.9% 42% None (many diffs) n/a
2 ccsbBroad304_11988 pLX_304 0% 44.9% 42% V5 (many diffs) n/a
3 TRCN0000480156 CGGCCTGGATCGGAATGTCCCTAA pLX_317 79.8% 44.9% 42% V5 (many diffs) n/a
Download CSV