Transcript: Mouse XM_011238864.2

PREDICTED: Mus musculus SET and MYND domain containing 3 (Smyd3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smyd3 (69726)
Length:
1266
CDS:
103..1251

Additional Resources:

NCBI RefSeq record:
XM_011238864.2
NBCI Gene record:
Smyd3 (69726)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238864.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123368 GATCTGCAATTCGTTCACTAT pLKO.1 636 CDS 100% 4.950 6.930 N Smyd3 n/a
2 TRCN0000123365 CGTTGTTCTCAATGCCGAATT pLKO.1 283 CDS 100% 0.000 0.000 N Smyd3 n/a
3 TRCN0000123366 GCTTCCCGACATCAACATCTA pLKO.1 1059 CDS 100% 4.950 3.465 N Smyd3 n/a
4 TRCN0000123367 GAGCAAATATGGAAGGAGGTT pLKO.1 940 CDS 100% 2.640 1.848 N Smyd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238864.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08862 pDONR223 100% 77.2% 80.1% None (many diffs) n/a
2 ccsbBroad304_08862 pLX_304 0% 77.2% 80.1% V5 (many diffs) n/a
3 TRCN0000473342 TGCATATGGCCGTAGACGGCTAGT pLX_317 38.4% 77.2% 80.1% V5 (many diffs) n/a
4 ccsbBroadEn_12481 pDONR223 100% 39.1% 39.2% None (many diffs) n/a
5 ccsbBroad304_12481 pLX_304 0% 39.1% 39.2% V5 (many diffs) n/a
6 TRCN0000479013 CTTTCTAGTAATTGAAGCAAACCG pLX_317 48.9% 39.1% 39.2% V5 (many diffs) n/a
Download CSV