Transcript: Mouse XM_011238932.2

PREDICTED: Mus musculus calcium/calmodulin-dependent protein kinase I gamma (Camk1g), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Camk1g (215303)
Length:
2538
CDS:
181..1656

Additional Resources:

NCBI RefSeq record:
XM_011238932.2
NBCI Gene record:
Camk1g (215303)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368859 AGACTGGACCCATTATCATAG pLKO_005 2118 3UTR 100% 10.800 15.120 N Camk1g n/a
2 TRCN0000361992 GCTGCTCCAGCTGTCTAAATA pLKO_005 1478 CDS 100% 15.000 10.500 N Camk1g n/a
3 TRCN0000361994 AGGTCTTGTCTGCGGTGAAAT pLKO_005 557 CDS 100% 13.200 9.240 N Camk1g n/a
4 TRCN0000024344 CCTCTTCAGAAAGGCCAATAA pLKO.1 1539 CDS 100% 13.200 9.240 N Camk1g n/a
5 TRCN0000361993 CTCCGTTCTGGGATGACATTT pLKO_005 941 CDS 100% 13.200 9.240 N Camk1g n/a
6 TRCN0000024348 CTTTGCTCTGAAATGTATCAA pLKO.1 324 CDS 100% 5.625 3.938 N Camk1g n/a
7 TRCN0000024345 CTATCCAAGATGGAGCAGAAT pLKO.1 679 CDS 100% 4.950 3.465 N Camk1g n/a
8 TRCN0000024347 GAAGAAACAGACCACCAACAT pLKO.1 216 CDS 100% 4.950 3.465 N Camk1g n/a
9 TRCN0000024346 CCTTTCTATGAAGAAACAGAA pLKO.1 874 CDS 100% 0.495 0.347 N Camk1g n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08716 pDONR223 100% 85.2% 89.4% None (many diffs) n/a
2 ccsbBroad304_08716 pLX_304 0% 85.2% 89.4% V5 (many diffs) n/a
3 TRCN0000480192 GCCGACGCGCCTATTTATCTAAAC pLX_317 28.5% 85.2% 89.4% V5 (many diffs) n/a
4 ccsbBroadEn_15122 pDONR223 0% 85.2% 89.4% None (many diffs) n/a
5 ccsbBroad304_15122 pLX_304 0% 85.2% 89.4% V5 (many diffs) n/a
6 TRCN0000489614 GCGCCCCAGGGCCCTTGACTTACG pLX_317 24.7% 85.2% 89.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV