Transcript: Mouse XM_011240300.2

PREDICTED: Mus musculus tripartite motif-containing 2 (Trim2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trim2 (80890)
Length:
7446
CDS:
542..2788

Additional Resources:

NCBI RefSeq record:
XM_011240300.2
NBCI Gene record:
Trim2 (80890)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240300.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303297 TTTGATGGGAGTGGATCATTT pLKO_005 2639 CDS 100% 13.200 18.480 N TRIM2 n/a
2 TRCN0000037308 CGTGGACTCAAATGGGAACAT pLKO.1 2581 CDS 100% 4.950 6.930 N Trim2 n/a
3 TRCN0000308331 CGTGGACTCAAATGGGAACAT pLKO_005 2581 CDS 100% 4.950 6.930 N Trim2 n/a
4 TRCN0000037304 CCCATCAGAATCAATGCAAAT pLKO.1 3346 3UTR 100% 10.800 7.560 N Trim2 n/a
5 TRCN0000308395 CCCATCAGAATCAATGCAAAT pLKO_005 3346 3UTR 100% 10.800 7.560 N Trim2 n/a
6 TRCN0000037307 GCTCTTCAGTTCATCTCAGAA pLKO.1 1085 CDS 100% 4.950 3.465 N Trim2 n/a
7 TRCN0000308325 GCTCTTCAGTTCATCTCAGAA pLKO_005 1085 CDS 100% 4.950 3.465 N Trim2 n/a
8 TRCN0000037306 GCACATTATTGTGGTGGACAA pLKO.1 2302 CDS 100% 4.050 2.835 N Trim2 n/a
9 TRCN0000308394 GCACATTATTGTGGTGGACAA pLKO_005 2302 CDS 100% 4.050 2.835 N Trim2 n/a
10 TRCN0000037305 CGCCAGATTGACAAGCAGTTT pLKO.1 581 CDS 100% 4.950 2.970 N Trim2 n/a
11 TRCN0000308329 CGCCAGATTGACAAGCAGTTT pLKO_005 581 CDS 100% 4.950 2.970 N Trim2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240300.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02752 pDONR223 100% 90.4% 98.6% None (many diffs) n/a
2 ccsbBroad304_02752 pLX_304 0% 90.4% 98.6% V5 (many diffs) n/a
3 TRCN0000471497 ACCACCTGACCTTTTGCAACCCGA pLX_317 16% 90.4% 98.6% V5 (many diffs) n/a
Download CSV