Transcript: Mouse XM_011240532.1

PREDICTED: Mus musculus podocan (Podn), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Podn (242608)
Length:
2466
CDS:
338..1537

Additional Resources:

NCBI RefSeq record:
XM_011240532.1
NBCI Gene record:
Podn (242608)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176176 GCTGCACCTCAAGAACAATAA pLKO.1 430 CDS 100% 13.200 9.240 N Podn n/a
2 TRCN0000175597 CAAGAAGGCTTGGAAGAGAAA pLKO.1 2253 3UTR 100% 4.950 3.465 N Podn n/a
3 TRCN0000175467 CACAACCAGATTACAGGCATA pLKO.1 869 CDS 100% 4.050 2.835 N Podn n/a
4 TRCN0000175702 GCACCTCAAGAACAATAAGCT pLKO.1 433 CDS 100% 3.000 2.100 N Podn n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1826 3UTR 100% 4.950 2.475 Y KAAG1 n/a
6 TRCN0000143232 GAAGAGGAAGATGAGGAAGAA pLKO.1 1505 CDS 100% 4.950 2.475 Y ARMH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14372 pDONR223 100% 86.7% 92.2% None (many diffs) n/a
2 ccsbBroad304_14372 pLX_304 0% 86.7% 92.2% V5 (many diffs) n/a
3 TRCN0000468136 CCCAGTTGCAGAGTGTCGAATTCC pLX_317 34.7% 86.7% 92.2% V5 (many diffs) n/a
4 ccsbBroadEn_09507 pDONR223 100% 52.9% 56.4% None (many diffs) n/a
5 ccsbBroad304_09507 pLX_304 0% 52.9% 56.4% V5 (many diffs) n/a
6 TRCN0000479035 CTTGATCTACGCTTGTCTGCTGAA pLX_317 19.7% 52.9% 56.4% V5 (many diffs) n/a
Download CSV