Transcript: Mouse XM_011241829.2

PREDICTED: Mus musculus family with sequence similarity 168, member A (Fam168a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam168a (319604)
Length:
5621
CDS:
19..600

Additional Resources:

NCBI RefSeq record:
XM_011241829.2
NBCI Gene record:
Fam168a (319604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217449 GATCCAACAAAGTACGTTAAC pLKO.1 4427 3UTR 100% 10.800 15.120 N Fam168a n/a
2 TRCN0000202186 CATCACCCAATCCCTATCAGA pLKO.1 239 CDS 100% 3.000 4.200 N Fam168a n/a
3 TRCN0000192682 GTATCCAATCAGAAGTGCCTA pLKO.1 267 CDS 100% 2.640 3.696 N Fam168a n/a
4 TRCN0000264244 CCTATCAGACGGCCATGTATC pLKO_005 251 CDS 100% 10.800 8.640 N FAM168A n/a
5 TRCN0000189924 GAACATGGCCTACACTGGTTA pLKO.1 72 CDS 100% 4.950 3.465 N Fam168a n/a
6 TRCN0000190202 CCTAAGAACATGGCCTACACT pLKO.1 67 CDS 100% 3.000 2.100 N Fam168a n/a
7 TRCN0000173087 CAGATGAGGAAACTGAGGCTT pLKO.1 1749 3UTR 100% 2.640 1.320 Y FLJ45966 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02736 pDONR223 100% 77.4% 81.7% None (many diffs) n/a
2 ccsbBroad304_02736 pLX_304 0% 77.4% 81.7% V5 (many diffs) n/a
3 TRCN0000469372 TCTCTTAAGACTTCGACGTGGACC pLX_317 53.7% 77.4% 81.7% V5 (many diffs) n/a
Download CSV