Transcript: Mouse XM_011242382.2

PREDICTED: Mus musculus family with sequence similarity 118, member B (Fam118b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam118b (109229)
Length:
1702
CDS:
144..1199

Additional Resources:

NCBI RefSeq record:
XM_011242382.2
NBCI Gene record:
Fam118b (109229)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148569 CCAGTAATGTTCGATCCACAT pLKO.1 487 CDS 100% 4.050 5.670 N FAM118B n/a
2 TRCN0000197636 CATGACTTGAAGCTCTAGTTT pLKO.1 1608 3UTR 100% 5.625 4.500 N Fam118b n/a
3 TRCN0000176645 CACTGAAGTTATGAGAGAGAT pLKO.1 827 CDS 100% 4.950 3.960 N Fam118b n/a
4 TRCN0000279483 CACTGAAGTTATGAGAGAGAT pLKO_005 827 CDS 100% 4.950 3.960 N Fam118b n/a
5 TRCN0000182034 CGAGAACTTGTGCTGGTGATT pLKO.1 264 CDS 100% 4.950 3.960 N Fam118b n/a
6 TRCN0000147936 GTGAAATAAGAGGCTGTAGTA pLKO.1 1174 CDS 100% 4.950 3.960 N FAM118B n/a
7 TRCN0000217818 CTTACTGGATGCTGCTATTGA pLKO.1 356 CDS 100% 5.625 3.938 N Fam118b n/a
8 TRCN0000177019 GAGATTCAGAAACTCTATGAA pLKO.1 843 CDS 100% 5.625 3.938 N Fam118b n/a
9 TRCN0000279482 GAGATTCAGAAACTCTATGAA pLKO_005 843 CDS 100% 5.625 3.938 N Fam118b n/a
10 TRCN0000130258 CCTTGACCTTACTGATGAGAA pLKO.1 686 CDS 100% 4.950 3.465 N FAM118B n/a
11 TRCN0000176987 GTCAAGCATAAATCTGACCTA pLKO.1 939 CDS 100% 2.640 1.848 N Fam118b n/a
12 TRCN0000279484 GTCAAGCATAAATCTGACCTA pLKO_005 939 CDS 100% 2.640 1.848 N Fam118b n/a
13 TRCN0000217707 GCAAGAGAAGGTCAGCTAAAT pLKO.1 1134 CDS 100% 13.200 7.920 N Fam118b n/a
14 TRCN0000181642 GCCTTCCTGTGGATGTGTTAA pLKO.1 1237 3UTR 100% 13.200 7.920 N Fam118b n/a
15 TRCN0000279416 GCCTTCCTGTGGATGTGTTAA pLKO_005 1237 3UTR 100% 13.200 7.920 N Fam118b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04088 pDONR223 100% 91.6% 98% None (many diffs) n/a
2 ccsbBroad304_04088 pLX_304 0% 91.6% 98% V5 (many diffs) n/a
3 TRCN0000471505 GCTAAGCCCAAGAACTTAACACGT pLX_317 47.9% 91.6% 98% V5 (many diffs) n/a
Download CSV