Transcript: Mouse XM_011243348.1

PREDICTED: Mus musculus cryptochrome 1 (photolyase-like) (Cry1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cry1 (12952)
Length:
2425
CDS:
107..1813

Additional Resources:

NCBI RefSeq record:
XM_011243348.1
NBCI Gene record:
Cry1 (12952)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176255 CAGCCACCTCTAACATATAAA pLKO.1 425 CDS 100% 15.000 12.000 N Cry1 n/a
2 TRCN0000337709 CAGCCACCTCTAACATATAAA pLKO_005 425 CDS 100% 15.000 12.000 N Cry1 n/a
3 TRCN0000216310 GACTATATTAGGCGTTATTTA pLKO.1 1271 CDS 100% 15.000 12.000 N Cry1 n/a
4 TRCN0000337711 ACATCAGTGTTTGATCTAATT pLKO_005 2219 3UTR 100% 13.200 9.240 N Cry1 n/a
5 TRCN0000173610 GCTCTCAAGGAAGTGGTATTT pLKO.1 1641 CDS 100% 13.200 9.240 N Cry1 n/a
6 TRCN0000337643 GCTCTCAAGGAAGTGGTATTT pLKO_005 1641 CDS 100% 13.200 9.240 N Cry1 n/a
7 TRCN0000194462 GAGGATCTTGATGCCAATCTA pLKO.1 170 CDS 100% 5.625 3.938 N Cry1 n/a
8 TRCN0000175971 GCAAGCAGACTGAATATTGAA pLKO.1 1418 CDS 100% 5.625 3.938 N Cry1 n/a
9 TRCN0000337642 GCAAGCAGACTGAATATTGAA pLKO_005 1418 CDS 100% 5.625 3.938 N Cry1 n/a
10 TRCN0000011308 GACAAGATCATAGAACTCAAT pLKO.1 398 CDS 100% 4.950 3.465 N CRY1 n/a
11 TRCN0000173481 GCCAAGTGTTTGATAGGAGTT pLKO.1 1364 CDS 100% 4.050 2.835 N Cry1 n/a
12 TRCN0000350877 GCCAAGTGTTTGATAGGAGTT pLKO_005 1364 CDS 100% 4.050 2.835 N Cry1 n/a
13 TRCN0000193765 CAAGGAATGGAACATCACTAA pLKO.1 256 CDS 100% 4.950 2.970 N Cry1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06040 pDONR223 100% 79% 83.7% None (many diffs) n/a
2 ccsbBroad304_06040 pLX_304 37.9% 79% 83.7% V5 (many diffs) n/a
3 TRCN0000466669 ACCGCCTCACAAACATCCCGGGCA pLX_317 11.6% 79% 83.7% V5 (many diffs) n/a
4 TRCN0000489831 CATATGCTTGTGTTTTGGCCGGAA pLX_317 22.2% 79% 83.7% V5 (many diffs) n/a
5 TRCN0000492211 TAGTACAGGGTCGCGACACTTACG pLX_317 20.9% 79% 83.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV