Transcript: Mouse XM_011243730.2

PREDICTED: Mus musculus SEC14-like lipid binding 3 (Sec14l3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec14l3 (380683)
Length:
3716
CDS:
169..1212

Additional Resources:

NCBI RefSeq record:
XM_011243730.2
NBCI Gene record:
Sec14l3 (380683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101990 CTTCTCTCCTTTAATTCCTAA pLKO.1 1257 3UTR 100% 4.950 3.465 N Sec14l3 n/a
2 TRCN0000101991 GTGATGATATTTGACTGTGAA pLKO.1 454 CDS 100% 4.950 3.465 N Sec14l3 n/a
3 TRCN0000101994 TCCTCACATCAGGTGGAGTAT pLKO.1 871 CDS 100% 4.950 3.465 N Sec14l3 n/a
4 TRCN0000101992 GACCCTGAAATTCATGCTCAT pLKO.1 558 CDS 100% 4.050 2.835 N Sec14l3 n/a
5 TRCN0000101993 CCAGGAACTTTGACCTACAGA pLKO.1 137 5UTR 100% 3.000 2.100 N Sec14l3 n/a
6 TRCN0000060053 CCCAAATGTTTAACCAAGATT pLKO.1 763 CDS 100% 5.625 3.938 N SEC14L3 n/a
7 TRCN0000088533 CGGGAGGCAGAGGCAGGCAAT pLKO.1 2537 3UTR 100% 0.000 0.000 Y Trrap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09928 pDONR223 100% 78.3% 83.5% None (many diffs) n/a
2 ccsbBroad304_09928 pLX_304 0% 78.3% 83.5% V5 (many diffs) n/a
3 TRCN0000478468 CTCCCCTGACGTATCCTGGTCACG pLX_317 10.7% 78.3% 83.5% V5 (many diffs) n/a
4 ccsbBroadEn_09929 pDONR223 100% 78.2% 83.2% None (many diffs) n/a
5 ccsbBroad304_09929 pLX_304 0% 78.2% 83.2% V5 (many diffs) n/a
6 TRCN0000477387 CTGTGATATGGCTGCATGTCTCTC pLX_317 34.1% 78.2% 83.2% V5 (many diffs) n/a
Download CSV