Transcript: Mouse XM_011244551.2

PREDICTED: Mus musculus autophagy related 10 (Atg10), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atg10 (66795)
Length:
2283
CDS:
830..1369

Additional Resources:

NCBI RefSeq record:
XM_011244551.2
NBCI Gene record:
Atg10 (66795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192097 CCAATACTTGGGCAACCATTT pLKO.1 1178 CDS 100% 10.800 15.120 N Atg10 n/a
2 TRCN0000350209 CCAATACTTGGGCAACCATTT pLKO_005 1178 CDS 100% 10.800 15.120 N Atg10 n/a
3 TRCN0000192489 CCAGTGGTTGGTCTGAATTTA pLKO.1 1310 CDS 100% 15.000 12.000 N Atg10 n/a
4 TRCN0000319975 CCAGTGGTTGGTCTGAATTTA pLKO_005 1310 CDS 100% 15.000 12.000 N Atg10 n/a
5 TRCN0000200892 CTCTGAGCTATGCTAAAGCAA pLKO.1 1332 CDS 100% 3.000 2.400 N Atg10 n/a
6 TRCN0000319976 CTCTGAGCTATGCTAAAGCAA pLKO_005 1332 CDS 100% 3.000 2.400 N Atg10 n/a
7 TRCN0000200999 CATCAGACATTCACAGCAGAT pLKO.1 883 CDS 100% 4.050 2.835 N Atg10 n/a
8 TRCN0000319974 CATCAGACATTCACAGCAGAT pLKO_005 883 CDS 100% 4.050 2.835 N Atg10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04294 pDONR223 100% 70% 70% None (many diffs) n/a
2 ccsbBroad304_04294 pLX_304 0% 70% 70% V5 (many diffs) n/a
3 TRCN0000468766 TCTCAATACCCAATGCCCTTTTTG pLX_317 68.8% 70% 70% V5 (many diffs) n/a
4 ccsbBroadEn_12754 pDONR223 100% 68.9% 62.5% None (many diffs) n/a
5 ccsbBroad304_12754 pLX_304 0% 68.9% 62.5% V5 (many diffs) n/a
6 TRCN0000481477 CGGTGAATTACTTTTATCTATGGA pLX_317 67.5% 68.9% 62.5% V5 (many diffs) n/a
Download CSV