Transcript: Mouse XM_011244643.2

PREDICTED: Mus musculus lipoma HMGIC fusion partner-like 2 (Lhfpl2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lhfpl2 (218454)
Length:
4343
CDS:
366..1034

Additional Resources:

NCBI RefSeq record:
XM_011244643.2
NBCI Gene record:
Lhfpl2 (218454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244643.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124159 CGCTAGAACAATCACTATGTT pLKO.1 3742 3UTR 100% 5.625 4.500 N Lhfpl2 n/a
2 TRCN0000124161 CACCTTTATCTGTGCTGTCTT pLKO.1 929 CDS 100% 4.950 3.465 N Lhfpl2 n/a
3 TRCN0000124163 GAATCGCAGGTCTGTTCCTTA pLKO.1 772 CDS 100% 4.950 3.465 N Lhfpl2 n/a
4 TRCN0000124160 CGTGCAAAGCATCATGAGGAA pLKO.1 719 CDS 100% 2.640 1.848 N Lhfpl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244643.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02343 pDONR223 100% 83.4% 84.3% None (many diffs) n/a
2 ccsbBroad304_02343 pLX_304 0% 83.4% 84.3% V5 (many diffs) n/a
Download CSV