Transcript: Mouse XM_011245123.2

PREDICTED: Mus musculus diaphanous related formin 3 (Diaph3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Diaph3 (56419)
Length:
4564
CDS:
122..3604

Additional Resources:

NCBI RefSeq record:
XM_011245123.2
NBCI Gene record:
Diaph3 (56419)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294829 ACACGAGGGACTCGGATTATT pLKO_005 670 CDS 100% 15.000 10.500 N Diaph3 n/a
2 TRCN0000108776 CCAGTTTAGAAGTGACTATAA pLKO.1 2338 CDS 100% 13.200 9.240 N Diaph3 n/a
3 TRCN0000108775 CCCAGTTTAGAAGTGACTATA pLKO.1 2337 CDS 100% 13.200 9.240 N Diaph3 n/a
4 TRCN0000287328 CCCAGTTTAGAAGTGACTATA pLKO_005 2337 CDS 100% 13.200 9.240 N Diaph3 n/a
5 TRCN0000150903 GCTCAGTGCTATTCTCTTTAA pLKO.1 2422 CDS 100% 13.200 9.240 N DIAPH3 n/a
6 TRCN0000294828 TGGACAAATTTGCCAGTATAA pLKO_005 240 CDS 100% 13.200 9.240 N Diaph3 n/a
7 TRCN0000151813 CAACATCAAACCTGACATCAT pLKO.1 2467 CDS 100% 4.950 3.465 N DIAPH3 n/a
8 TRCN0000108777 CCCTGACTTCACATACAGAAA pLKO.1 1453 CDS 100% 4.950 3.465 N Diaph3 n/a
9 TRCN0000287261 CCCTGACTTCACATACAGAAA pLKO_005 1453 CDS 100% 4.950 3.465 N Diaph3 n/a
10 TRCN0000108778 GCAGAGAAAGAGCGACTTGAA pLKO.1 3128 CDS 100% 4.950 3.465 N Diaph3 n/a
11 TRCN0000151078 GCATGAGAAGATTGAATTGGT pLKO.1 1959 CDS 100% 3.000 2.100 N DIAPH3 n/a
12 TRCN0000151516 CATCTCCTGATGATTTGGATT pLKO.1 1074 CDS 100% 4.950 3.465 N DIAPH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04249 pDONR223 100% 63.4% 62.3% None (many diffs) n/a
2 ccsbBroad304_04249 pLX_304 0% 63.4% 62.3% V5 (many diffs) n/a
3 TRCN0000491728 CTGAGATAATATTGGGAATCTTCT pLX_317 12.8% 63.4% 62.3% V5 (many diffs) n/a
Download CSV