Transcript: Mouse XM_011246055.3

PREDICTED: Mus musculus pyridoxal-dependent decarboxylase domain containing 1 (Pdxdc1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pdxdc1 (94184)
Length:
4216
CDS:
242..2563

Additional Resources:

NCBI RefSeq record:
XM_011246055.3
NBCI Gene record:
Pdxdc1 (94184)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246055.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247826 GATGGATTCAACGTGTTATAT pLKO_005 665 CDS 100% 15.000 21.000 N Pdxdc1 n/a
2 TRCN0000247824 GCCTCAGATTCAGCGTTTAAA pLKO_005 1373 CDS 100% 15.000 21.000 N Pdxdc1 n/a
3 TRCN0000247823 CCTTATGGCTACGCCGGATTT pLKO_005 540 CDS 100% 10.800 15.120 N Pdxdc1 n/a
4 TRCN0000192349 CCAGGATACTTTCAGACACTA pLKO.1 519 CDS 100% 4.950 3.960 N Pdxdc1 n/a
5 TRCN0000247825 CATAGCCTCGGTGCCTATATT pLKO_005 461 CDS 100% 15.000 10.500 N Pdxdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246055.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11663 pDONR223 100% 55.3% 58.3% None (many diffs) n/a
2 ccsbBroad304_11663 pLX_304 0% 55.3% 58.3% V5 (many diffs) n/a
3 TRCN0000475295 AGTCTTGCGTGTCTGTGAATAAAT pLX_317 24% 55.3% 58.3% V5 (many diffs) n/a
4 ccsbBroadEn_10342 pDONR223 100% 46.6% 48.3% None (many diffs) n/a
5 ccsbBroad304_10342 pLX_304 0% 46.6% 48.3% V5 (many diffs) n/a
6 TRCN0000479086 GTGACACGCCACTTGGAGCACCGT pLX_317 32% 46.6% 48.3% V5 (many diffs) n/a
Download CSV