Transcript: Mouse XM_011246412.2

PREDICTED: Mus musculus serine/arginine-rich splicing factor 7 (Srsf7), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Srsf7 (225027)
Length:
2727
CDS:
865..1281

Additional Resources:

NCBI RefSeq record:
XM_011246412.2
NBCI Gene record:
Srsf7 (225027)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071933 CGTCGTCCCTTTGATCCTAAT pLKO.1 404 5UTR 100% 10.800 15.120 N Srsf7 n/a
2 TRCN0000324749 CGTCGTCCCTTTGATCCTAAT pLKO_005 404 5UTR 100% 10.800 15.120 N Srsf7 n/a
3 TRCN0000273401 GATCAAGATCCAGGTCTATTT pLKO_005 1132 CDS 100% 13.200 10.560 N SRSF7 n/a
4 TRCN0000071935 GTTCGAGGATTGGATGGGAAA pLKO.1 305 5UTR 100% 4.050 3.240 N Srsf7 n/a
5 TRCN0000324747 GTTCGAGGATTGGATGGGAAA pLKO_005 305 5UTR 100% 4.050 3.240 N Srsf7 n/a
6 TRCN0000071937 CTGGTAAAGGAGAGTTAGAAA pLKO.1 180 5UTR 100% 5.625 3.938 N Srsf7 n/a
7 TRCN0000324683 CTGGTAAAGGAGAGTTAGAAA pLKO_005 180 5UTR 100% 5.625 3.938 N Srsf7 n/a
8 TRCN0000071936 CTGTGTCTCTTCGTAGATCAA pLKO.1 1069 CDS 100% 4.950 3.465 N Srsf7 n/a
9 TRCN0000324748 CTGTGTCTCTTCGTAGATCAA pLKO_005 1069 CDS 100% 4.950 3.465 N Srsf7 n/a
10 TRCN0000071934 GCTTATGACTGTCATCGCTAT pLKO.1 461 5UTR 100% 4.050 2.835 N Srsf7 n/a
11 TRCN0000001144 AGCAGGTTTCTTCGTTTGAGT pLKO.1 497 5UTR 100% 3.000 2.100 N SRSF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01525 pDONR223 100% 46.4% 3.7% None (many diffs) n/a
2 ccsbBroad304_01525 pLX_304 0% 46.4% 3.7% V5 (many diffs) n/a
3 TRCN0000467489 GCCCAGCAACTTAAATCGTCGGAT pLX_317 50.4% 46.4% 3.7% V5 (many diffs) n/a
Download CSV