Transcript: Mouse XM_011246575.2

PREDICTED: Mus musculus solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 (Slc25a23), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc25a23 (66972)
Length:
3418
CDS:
208..1650

Additional Resources:

NCBI RefSeq record:
XM_011246575.2
NBCI Gene record:
Slc25a23 (66972)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246575.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104564 GCATTCTACAGTCCTGGACAT pLKO.1 678 CDS 100% 4.050 3.240 N Slc25a23 n/a
2 TRCN0000104562 CACAGCTCAAACCATCATATA pLKO.1 1077 CDS 100% 13.200 9.240 N Slc25a23 n/a
3 TRCN0000104560 CCTGGATTACAGGTCCCTTAA pLKO.1 2317 3UTR 100% 10.800 7.560 N Slc25a23 n/a
4 TRCN0000104561 CGGAACCAAGATGGTCACATA pLKO.1 475 CDS 100% 4.950 3.465 N Slc25a23 n/a
5 TRCN0000104563 CTGAGAAACATGATTCAAGAA pLKO.1 889 CDS 100% 4.950 3.465 N Slc25a23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246575.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12542 pDONR223 100% 69.3% 71.6% None (many diffs) n/a
2 ccsbBroad304_12542 pLX_304 0% 69.3% 71.6% V5 (many diffs) n/a
3 TRCN0000478570 CGAAACTACGGCTGTCCGCAGGTA pLX_317 19% 69.3% 71.6% V5 (many diffs) n/a
Download CSV