Transcript: Mouse XM_011247193.1

PREDICTED: Mus musculus sorbin and SH3 domain containing 1 (Sorbs1), transcript variant X45, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sorbs1 (20411)
Length:
6829
CDS:
44..3820

Additional Resources:

NCBI RefSeq record:
XM_011247193.1
NBCI Gene record:
Sorbs1 (20411)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247193.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090589 CGCACCTATATCGAGCTTCTT pLKO.1 2432 CDS 100% 4.950 6.930 N Sorbs1 n/a
2 TRCN0000090591 GTCCTTTACTAAACGAAGTTT pLKO.1 858 CDS 100% 5.625 4.500 N Sorbs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247193.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11524 pDONR223 100% 43.4% 43.1% None (many diffs) n/a
2 ccsbBroad304_11524 pLX_304 0% 43.4% 43.1% V5 (many diffs) n/a
3 TRCN0000478353 GTCCATCCATTACTTGACCACCGT pLX_317 15.8% 43.4% 43.1% V5 (many diffs) n/a
Download CSV