Transcript: Mouse XM_011248501.2

PREDICTED: Mus musculus zinc finger, DHHC domain containing 1 (Zdhhc1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zdhhc1 (70796)
Length:
2057
CDS:
421..1875

Additional Resources:

NCBI RefSeq record:
XM_011248501.2
NBCI Gene record:
Zdhhc1 (70796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121376 GCGCCTGCAATAAGTGCGTAT pLKO.1 863 CDS 100% 4.050 5.670 N Zdhhc1 n/a
2 TRCN0000121373 GCTGAGTCCATGGAAGAGATT pLKO.1 1696 CDS 100% 4.950 3.960 N Zdhhc1 n/a
3 TRCN0000121374 CAAGCTCACCACCTATGAATA pLKO.1 1233 CDS 100% 13.200 9.240 N Zdhhc1 n/a
4 TRCN0000121372 CCTGCTCTGCTTCCACATTTA pLKO.1 1200 CDS 100% 13.200 9.240 N Zdhhc1 n/a
5 TRCN0000130583 CCTGCTCTGCTTCCACATTTA pLKO.1 1200 CDS 100% 13.200 9.240 N ZDHHC1 n/a
6 TRCN0000121375 GCTCACCACCTATGAATACAT pLKO.1 1236 CDS 100% 5.625 3.938 N Zdhhc1 n/a
7 TRCN0000148361 CTTCGTGGAGTTCTTTGTCAA pLKO.1 1011 CDS 100% 4.950 3.465 N ZDHHC1 n/a
8 TRCN0000146418 CATTCAGGAGATGGAGTTCTA pLKO.1 1332 CDS 100% 4.950 2.970 N ZDHHC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03094 pDONR223 100% 76% 68.3% None (many diffs) n/a
2 ccsbBroad304_03094 pLX_304 0% 76% 68.3% V5 (many diffs) n/a
3 TRCN0000477634 ATTCTTTCTGAAAAATAACACTAC pLX_317 15.7% 76% 68.3% V5 (many diffs) n/a
Download CSV