Transcript: Mouse XM_011249532.2

PREDICTED: Mus musculus septin 11 (Sept11), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sept11 (52398)
Length:
5048
CDS:
128..1444

Additional Resources:

NCBI RefSeq record:
XM_011249532.2
NBCI Gene record:
Sept11 (52398)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249532.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112987 CGGCTGAAGCTAACAATCGTT pLKO.1 431 CDS 100% 3.000 4.200 N Sept11 n/a
2 TRCN0000326431 CGGCTGAAGCTAACAATCGTT pLKO_005 431 CDS 100% 3.000 4.200 N Sept11 n/a
3 TRCN0000112986 GCACAAATTCAAGAGTAAGAT pLKO.1 733 CDS 100% 5.625 3.938 N Sept11 n/a
4 TRCN0000159372 GCACAAATTCAAGAGTAAGAT pLKO.1 733 CDS 100% 5.625 3.938 N SEPTIN11 n/a
5 TRCN0000281001 GCACAAATTCAAGAGTAAGAT pLKO_005 733 CDS 100% 5.625 3.938 N SEPTIN11 n/a
6 TRCN0000326491 GCACAAATTCAAGAGTAAGAT pLKO_005 733 CDS 100% 5.625 3.938 N Sept11 n/a
7 TRCN0000112988 CCACTTCTCAAGGATTCTGTT pLKO.1 258 CDS 100% 4.950 3.465 N Sept11 n/a
8 TRCN0000326353 CCACTTCTCAAGGATTCTGTT pLKO_005 258 CDS 100% 4.950 3.465 N Sept11 n/a
9 TRCN0000112985 CGGATCTTTCTGTTTCAGATT pLKO.1 3649 3UTR 100% 4.950 3.465 N Sept11 n/a
10 TRCN0000326430 CGGATCTTTCTGTTTCAGATT pLKO_005 3649 3UTR 100% 4.950 3.465 N Sept11 n/a
11 TRCN0000112989 CAAACCAAGAAGGACAAGGAT pLKO.1 1400 CDS 100% 3.000 2.100 N Sept11 n/a
12 TRCN0000326352 CAAACCAAGAAGGACAAGGAT pLKO_005 1400 CDS 100% 3.000 2.100 N Sept11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249532.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03648 pDONR223 100% 86.5% 94.3% None (many diffs) n/a
2 ccsbBroad304_03648 pLX_304 0% 86.5% 94.3% V5 (many diffs) n/a
3 TRCN0000476830 ATAGCAGCTAGTCCCGCTTTCCTT pLX_317 31.4% 86.5% 94.3% V5 (many diffs) n/a
Download CSV