Transcript: Mouse XM_011250584.2

PREDICTED: Mus musculus zinc finger protein 260 (Zfp260), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp260 (26466)
Length:
3558
CDS:
613..1836

Additional Resources:

NCBI RefSeq record:
XM_011250584.2
NBCI Gene record:
Zfp260 (26466)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096244 GCAGAGTGTATGGTTAGTAAT pLKO.1 1872 3UTR 100% 13.200 18.480 N Zfp260 n/a
2 TRCN0000096248 TCTCGAATTACATCGCTCATT pLKO.1 1537 CDS 100% 4.950 6.930 N Zfp260 n/a
3 TRCN0000096245 GCAGAAACAATACCTCATCAA pLKO.1 1455 CDS 100% 4.950 3.960 N Zfp260 n/a
4 TRCN0000147981 CCAGAAGCAATACCTCATTAA pLKO.1 1119 CDS 100% 13.200 9.240 N ZNF260 n/a
5 TRCN0000096247 CCGGAGAGAGTGTTTATGAAT pLKO.1 665 CDS 100% 5.625 3.938 N Zfp260 n/a
6 TRCN0000096246 CCACCGTTAGAAATCAGAGAA pLKO.1 965 CDS 100% 4.950 3.465 N Zfp260 n/a
7 TRCN0000015520 CTGGAGAGAAGCCTTATGAAT pLKO.1 1241 CDS 100% 5.625 2.813 Y ZNF625 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10011 pDONR223 100% 83.4% 85.6% None (many diffs) n/a
2 ccsbBroad304_10011 pLX_304 0% 83.4% 85.6% V5 (many diffs) n/a
3 TRCN0000477743 TGCCCTAATGTTTGGACCTAGTTT pLX_317 33.5% 83.4% 85.6% V5 (many diffs) n/a
4 ccsbBroadEn_10010 pDONR223 100% 83.4% 85.6% None (many diffs) n/a
5 ccsbBroad304_10010 pLX_304 0% 83.4% 85.6% V5 (many diffs) n/a
6 TRCN0000491758 AAAGACCTTGCATTATAACTTTTC pLX_317 34.4% 83.4% 85.6% V5 (many diffs) n/a
Download CSV