Transcript: Mouse XM_011250861.2

PREDICTED: Mus musculus calcium and integrin binding 1 (calmyrin) (Cib1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cib1 (23991)
Length:
953
CDS:
391..744

Additional Resources:

NCBI RefSeq record:
XM_011250861.2
NBCI Gene record:
Cib1 (23991)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380042 GACTTTGCCAGCTCCTTTAAG pLKO_005 712 CDS 100% 13.200 10.560 N CIB1 n/a
2 TRCN0000120586 CTTTGCCAGCTCCTTTAAGAT pLKO.1 714 CDS 100% 5.625 3.938 N Cib1 n/a
3 TRCN0000328454 CTTTGCCAGCTCCTTTAAGAT pLKO_005 714 CDS 100% 5.625 3.938 N Cib1 n/a
4 TRCN0000120585 GCTCAAGGCTAACCCTTTCAA pLKO.1 357 5UTR 100% 5.625 3.938 N Cib1 n/a
5 TRCN0000120583 CCAGACATCAAGTCACACTAT pLKO.1 478 CDS 100% 4.950 3.465 N Cib1 n/a
6 TRCN0000328391 CCAGACATCAAGTCACACTAT pLKO_005 478 CDS 100% 4.950 3.465 N Cib1 n/a
7 TRCN0000053589 GCCTTCCGCATCTTTGACTTT pLKO.1 499 CDS 100% 4.950 3.465 N CIB1 n/a
8 TRCN0000333330 GCCTTCCGCATCTTTGACTTT pLKO_005 499 CDS 100% 4.950 3.465 N CIB1 n/a
9 TRCN0000120582 GCTGAGATGTGGCCAAGGTTA pLKO.1 786 3UTR 100% 4.950 3.465 N Cib1 n/a
10 TRCN0000328455 AGTACCAACATCCTGTCCAAG pLKO_005 754 3UTR 100% 4.050 2.835 N Cib1 n/a
11 TRCN0000120584 CCGAGTATCGTTTGAGCAGAT pLKO.1 321 5UTR 100% 4.050 2.835 N Cib1 n/a
12 TRCN0000328395 GAAGCAGCTGATTGACAATAT pLKO_005 615 CDS 100% 13.200 7.920 N Cib1 n/a
13 TRCN0000328456 GGATGGGACCATCAATCTTTC pLKO_005 660 CDS 100% 10.800 6.480 N Cib1 n/a
14 TRCN0000053592 CCAGACTTTGCCAGCTCCTTT pLKO.1 709 CDS 100% 4.950 2.970 N CIB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14967 pDONR223 100% 54.9% 58.6% None (many diffs) n/a
2 ccsbBroad304_14967 pLX_304 0% 54.9% 58.6% V5 (many diffs) n/a
3 TRCN0000467943 GTCCACGAAGTGATTACTTGTGCA pLX_317 60% 54.9% 58.6% V5 (many diffs) n/a
4 ccsbBroadEn_14970 pDONR223 100% 54.9% 58.6% None (many diffs) n/a
5 ccsbBroad304_14970 pLX_304 0% 54.9% 58.6% V5 (many diffs) n/a
Download CSV