Transcript: Human XM_011509119.1

PREDICTED: Homo sapiens peptidoglycan recognition protein 3 (PGLYRP3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PGLYRP3 (114771)
Length:
1767
CDS:
375..1400

Additional Resources:

NCBI RefSeq record:
XM_011509119.1
NBCI Gene record:
PGLYRP3 (114771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509119.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056749 GTCCGAAACATACAGTCCTTT pLKO.1 1044 CDS 100% 4.950 6.930 N PGLYRP3 n/a
2 TRCN0000056748 CCCAGGTATATTCAGCCACTT pLKO.1 828 CDS 100% 4.050 5.670 N PGLYRP3 n/a
3 TRCN0000056750 GCATCGCCTTCTTTGGCAATA pLKO.1 724 CDS 100% 10.800 8.640 N PGLYRP3 n/a
4 TRCN0000056751 CACTTATGGATTCAACGATAT pLKO.1 1166 CDS 100% 10.800 7.560 N PGLYRP3 n/a
5 TRCN0000425950 GCCAAATATGTCATCATCATC pLKO_005 975 CDS 100% 4.950 3.465 N PGLYRP3 n/a
6 TRCN0000056752 GCAGAGCGTTTGCAGCCAGAT pLKO.1 551 CDS 100% 1.350 0.945 N PGLYRP3 n/a
7 TRCN0000437709 ACAGTGACGTGGTCAACATCC pLKO_005 1321 CDS 100% 4.050 2.430 N PGLYRP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509119.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16076 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16076 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476168 TCTGTTCCAACGTTATGTCGCCAA pLX_317 34% 100% 100% V5 n/a
4 ccsbBroadEn_09398 pDONR223 100% 99.9% 100% None 1002C>T n/a
5 ccsbBroad304_09398 pLX_304 0% 99.9% 100% V5 1002C>T n/a
6 TRCN0000476670 TTCATTTCTCGCAAATACAGCTTC pLX_317 41.9% 99.9% 100% V5 1002C>T n/a
7 ccsbBroad304_01611 pLX_304 22.5% 32.1% 3.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV