Transcript: Human XM_011509251.3

PREDICTED: Homo sapiens DENN domain containing 1B (DENND1B), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND1B (163486)
Length:
2562
CDS:
58..1401

Additional Resources:

NCBI RefSeq record:
XM_011509251.3
NBCI Gene record:
DENND1B (163486)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509251.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130880 GCCATACCTGATTGGAATACA pLKO.1 984 CDS 100% 5.625 7.875 N DENND1B n/a
2 TRCN0000127666 CAATGCCATACCTGATTGGAA pLKO.1 980 CDS 100% 3.000 2.100 N DENND1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509251.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09752 pDONR223 100% 82.4% 79.3% None (many diffs) n/a
2 ccsbBroad304_09752 pLX_304 0% 82.4% 79.3% V5 (many diffs) n/a
3 TRCN0000472421 TCCAGGGGAAATTTCGAATCAGTT pLX_317 35% 82.4% 79.3% V5 (many diffs) n/a
4 ccsbBroadEn_13336 pDONR223 100% 74.5% 69.3% None (many diffs) n/a
5 ccsbBroad304_13336 pLX_304 0% 74.5% 69.3% V5 (many diffs) n/a
6 TRCN0000480837 CTCGATCCCTCTGATTCGAACTAC pLX_317 39.5% 74.5% 69.3% V5 (many diffs) n/a
Download CSV