Transcript: Human XM_011510415.2

PREDICTED: Homo sapiens radical S-adenosyl methionine domain containing 2 (RSAD2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RSAD2 (91543)
Length:
3350
CDS:
172..1053

Additional Resources:

NCBI RefSeq record:
XM_011510415.2
NBCI Gene record:
RSAD2 (91543)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425037 GAGTCGCTTTCAAGATAAATT pLKO_005 611 CDS 100% 15.000 21.000 N RSAD2 n/a
2 TRCN0000434261 GATTCTTGGAGCGCCACAAAG pLKO_005 800 CDS 100% 10.800 15.120 N RSAD2 n/a
3 TRCN0000428594 CCAGAATTATGGTGAGTATTT pLKO_005 465 CDS 100% 13.200 10.560 N RSAD2 n/a
4 TRCN0000056670 CGAGGAAGTCAATGTCCTTAT pLKO.1 519 CDS 100% 10.800 8.640 N RSAD2 n/a
5 TRCN0000365919 GATGAAAGACTCCTACCTTAT pLKO_005 855 CDS 100% 10.800 7.560 N Rsad2 n/a
6 TRCN0000056671 GCCTGAATCTAACCAGAAGAT pLKO.1 837 CDS 100% 4.950 3.465 N RSAD2 n/a
7 TRCN0000056669 GCGCTTTCTGAACTGTAGAAA pLKO.1 891 CDS 100% 0.563 0.394 N RSAD2 n/a
8 TRCN0000056668 GCTCAGAGAAAGCAAGCATAA pLKO.1 2232 3UTR 100% 10.800 6.480 N RSAD2 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2848 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2849 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09317 pDONR223 100% 77.2% 65% None (many diffs) n/a
2 ccsbBroad304_09317 pLX_304 0% 77.2% 65% V5 (many diffs) n/a
3 TRCN0000481536 CCACCCTGATCGGTACCGTTCCGG pLX_317 38.4% 77.2% 65% V5 (many diffs) n/a
Download CSV