Transcript: Human XM_011511516.2

PREDICTED: Homo sapiens SPC25 component of NDC80 kinetochore complex (SPC25), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPC25 (57405)
Length:
1042
CDS:
141..701

Additional Resources:

NCBI RefSeq record:
XM_011511516.2
NBCI Gene record:
SPC25 (57405)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161270 GAACGAATGGTTGAGATGTTT pLKO.1 303 CDS 100% 5.625 7.875 N SPC25 n/a
2 TRCN0000159115 GACTTGTATAAAGATCGACTT pLKO.1 546 CDS 100% 4.050 5.670 N SPC25 n/a
3 TRCN0000164090 CTGACTGCAAATATCCAGGAT pLKO.1 435 CDS 100% 2.640 3.696 N SPC25 n/a
4 TRCN0000161644 GCAGACTTGTATAAAGATCGA pLKO.1 543 CDS 100% 2.640 2.112 N SPC25 n/a
5 TRCN0000159746 GTTGAGATGTTTCTGGAATAT pLKO.1 312 CDS 100% 13.200 9.240 N SPC25 n/a
6 TRCN0000162109 CAAGGATTCCATCAAAGCATT pLKO.1 248 CDS 100% 4.950 3.465 N SPC25 n/a
7 TRCN0000161787 CCATCAAAGCATTTGCAGAAA pLKO.1 256 CDS 100% 4.950 3.465 N SPC25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03816 pDONR223 100% 82.4% 82.1% None (many diffs) n/a
2 ccsbBroad304_03816 pLX_304 0% 82.4% 82.1% V5 (many diffs) n/a
3 TRCN0000491603 TCTGGCGAGGCCCAATCTCTTCGC pLX_317 57.2% 82.4% 82.1% V5 (many diffs) n/a
Download CSV