Transcript: Human XM_011511892.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 19 (MAP3K19), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K19 (80122)
Length:
5085
CDS:
740..4726

Additional Resources:

NCBI RefSeq record:
XM_011511892.1
NBCI Gene record:
MAP3K19 (80122)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511892.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196258 GCAGACGTATCACCAATAAAT pLKO.1 2820 CDS 100% 15.000 21.000 N MAP3K19 n/a
2 TRCN0000355773 TGGCTCAATCTCTAGTATTAT pLKO_005 4174 CDS 100% 15.000 21.000 N MAP3K19 n/a
3 TRCN0000002392 TCTGGCTATGGACGGAAATCA pLKO.1 4463 CDS 100% 5.625 4.500 N MAP3K19 n/a
4 TRCN0000363113 ACACGTATTACCGTGAGATAT pLKO_005 2784 CDS 100% 13.200 9.240 N MAP3K19 n/a
5 TRCN0000355772 CCGACAGAGCCAAGACTAAAT pLKO_005 2639 CDS 100% 13.200 9.240 N MAP3K19 n/a
6 TRCN0000002394 GATGGTGTTCTGTAAATATAC pLKO.1 4219 CDS 100% 13.200 9.240 N MAP3K19 n/a
7 TRCN0000002391 AGCATTGGTTGTACTGTGTTT pLKO.1 4493 CDS 100% 4.950 3.465 N MAP3K19 n/a
8 TRCN0000002393 GAGCATTGGTTGTACTGTGTT pLKO.1 4492 CDS 100% 4.950 3.465 N MAP3K19 n/a
9 TRCN0000194794 CCAACTGATTTGATGACAGTT pLKO.1 812 CDS 100% 0.495 0.347 N MAP3K19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511892.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12670 pDONR223 100% 12.6% 12.6% None 1_3417del;3922_3984del n/a
2 ccsbBroad304_12670 pLX_304 0% 12.6% 12.6% V5 1_3417del;3922_3984del n/a
3 TRCN0000472170 GAGAGAACCACCTCTTATGACATC pLX_317 98.8% 12.6% 12.6% V5 1_3417del;3922_3984del n/a
4 ccsbBroadEn_15162 pDONR223 0% 12.6% 12.6% None 1_3417del;3922_3984del n/a
5 ccsbBroad304_15162 pLX_304 0% 12.6% 12.6% V5 1_3417del;3922_3984del n/a
6 TRCN0000467073 TGCAGCGACGCCTCGATCAATGGT pLX_317 60.4% 12.6% 12.6% V5 1_3417del;3922_3984del n/a
Download CSV