Transcript: Human XM_011512171.2

PREDICTED: Homo sapiens serine/threonine kinase 17b (STK17B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STK17B (9262)
Length:
4670
CDS:
202..936

Additional Resources:

NCBI RefSeq record:
XM_011512171.2
NBCI Gene record:
STK17B (9262)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010157 TTACCTGAGTTGGCTGAAATG pLKO.1 184 5UTR 100% 10.800 15.120 N STK17B n/a
2 TRCN0000000783 CAGAGGATAGCAGCATGGTTT pLKO.1 848 CDS 100% 4.950 6.930 N STK17B n/a
3 TRCN0000010158 AGCAGCATATACCCTCTCGGG pLKO.1 316 CDS 100% 0.180 0.252 N STK17B n/a
4 TRCN0000435861 ACCATGCCTCTATCAACATAA pLKO_005 1339 3UTR 100% 13.200 9.240 N STK17B n/a
5 TRCN0000000782 ACTTCTAAATCCTCCTGTAAT pLKO.1 790 CDS 100% 13.200 9.240 N STK17B n/a
6 TRCN0000000780 CCAGTGAGATTATGATTTGTA pLKO.1 987 3UTR 100% 5.625 3.938 N STK17B n/a
7 TRCN0000194872 CTTTGACTCATTTGGACTGAA pLKO.1 946 3UTR 100% 4.950 3.465 N STK17B n/a
8 TRCN0000195255 GATATGCCTTTCTCATTCTTG pLKO.1 672 CDS 100% 4.950 3.465 N STK17B n/a
9 TRCN0000196640 GCATATATGTTGTTAACTCAC pLKO.1 490 CDS 100% 4.050 2.835 N STK17B n/a
10 TRCN0000010154 GCCACAGACTTTATTCAGAGC pLKO.1 613 CDS 100% 2.160 1.512 N STK17B n/a
11 TRCN0000196693 GTTAAATTACTAGTTGCTAGC pLKO.1 1077 3UTR 100% 0.000 0.000 N STK17B n/a
12 TRCN0000000781 GATAGAGAAGACAAAGAGAAT pLKO.1 823 CDS 100% 4.950 2.970 N STK17B n/a
13 TRCN0000010155 GATAGAGAAGACAAAGAGAAT pLKO.1 823 CDS 100% 4.950 2.970 N STK17B n/a
14 TRCN0000195086 CATGGAATAATTTAGGGAAGT pLKO.1 1048 3UTR 100% 4.050 2.430 N STK17B n/a
15 TRCN0000010548 TGTTTACCTGAGTTGGCTGAA pLKO.1 181 5UTR 100% 4.050 2.430 N STK17B n/a
16 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2845 3UTR 100% 5.625 2.813 Y KLHL30 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2845 3UTR 100% 5.625 2.813 Y EID2B n/a
18 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 2644 3UTR 100% 4.950 2.475 Y CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489402 TAGACTCGTCGCGTCGTCTGCCGT pLX_317 27.5% 65.5% 65.5% V5 (not translated due to prior stop codon) 0_1ins384 n/a
2 ccsbBroadEn_07382 pDONR223 100% 65.5% 65.5% None 0_1ins384;357T>C n/a
3 ccsbBroad304_07382 pLX_304 0% 65.5% 65.5% V5 0_1ins384;357T>C n/a
4 TRCN0000467322 GTATTCAGCATCTCTCAATGAAGC pLX_317 35.8% 65.5% 65.5% V5 0_1ins384;357T>C n/a
5 ccsbBroadEn_14936 pDONR223 0% 65.5% 65.5% None 0_1ins384;357T>C n/a
6 ccsbBroad304_14936 pLX_304 0% 65.5% 65.5% V5 0_1ins384;357T>C n/a
7 TRCN0000471394 TCCACTCACTCCCTTAAACAAGTA pLX_317 38.7% 65.5% 65.5% V5 0_1ins384;357T>C n/a
8 TRCN0000491895 AGCCCTGCGATTTCACCTTTTCGG pLX_317 22.2% 65.4% 65.4% V5 0_1ins384;357T>C;732_733insG n/a
Download CSV