Transcript: Human XM_011513777.3

PREDICTED: Homo sapiens cytoplasmic polyadenylation element binding protein 2 (CPEB2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPEB2 (132864)
Length:
4035
CDS:
224..3313

Additional Resources:

NCBI RefSeq record:
XM_011513777.3
NBCI Gene record:
CPEB2 (132864)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232778 GTCATAGCACCACCGAAATTT pLKO_005 2054 CDS 100% 15.000 21.000 N CPEB2 n/a
2 TRCN0000192024 CGTCCTTGGAATTTAAGTGAT pLKO.1 2798 CDS 100% 4.950 6.930 N Cpeb2 n/a
3 TRCN0000148102 GCACTCATTGATGCTTGTATT pLKO.1 2711 CDS 100% 13.200 10.560 N CPEB2 n/a
4 TRCN0000232780 AGCTTCAGCATGGTGATATTG pLKO_005 3057 CDS 100% 13.200 9.240 N CPEB2 n/a
5 TRCN0000232779 AGGTGTTCCTAGGCCATTAAG pLKO_005 2878 CDS 100% 13.200 9.240 N CPEB2 n/a
6 TRCN0000339380 CCTACATCTCAGGCTTACTAA pLKO_005 3492 3UTR 100% 5.625 3.938 N Cpeb2 n/a
7 TRCN0000192926 GCTCAGATTCACTCCAAGATA pLKO.1 2208 CDS 100% 5.625 3.938 N Cpeb2 n/a
8 TRCN0000150178 GTGTTCAGAACAGACAACAAT pLKO.1 2123 CDS 100% 5.625 3.938 N CPEB2 n/a
9 TRCN0000200685 GTCCTTGGAATTTAAGTGATA pLKO.1 2799 CDS 100% 4.950 3.465 N Cpeb2 n/a
10 TRCN0000149652 GCATCTTTATCAGCAGCCAAA pLKO.1 3440 3UTR 100% 4.050 2.835 N CPEB2 n/a
11 TRCN0000149728 GAGTTCCATAAGCCATTGGTA pLKO.1 3245 CDS 100% 3.000 2.100 N CPEB2 n/a
12 TRCN0000232777 GCAGCAGAGGAACTCCTATAA pLKO_005 1855 CDS 100% 13.200 7.920 N CPEB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13173 pDONR223 100% 52% 52% None (many diffs) n/a
2 ccsbBroad304_13173 pLX_304 0% 52% 52% V5 (many diffs) n/a
3 TRCN0000477873 CAGCACTTATTCCGCAATTATGCG pLX_317 21% 52% 52% V5 (many diffs) n/a
4 ccsbBroadEn_12692 pDONR223 100% 24.8% 28.4% None (many diffs) n/a
5 ccsbBroad304_12692 pLX_304 0% 24.8% 28.4% V5 (many diffs) n/a
6 TRCN0000491501 CTTGCGGGTGCGAGCAGGAATTAG pLX_317 35.5% 24.8% 28.4% V5 (many diffs) n/a
Download CSV