Construct: ORF TRCN0000491501
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005176.1_s317c1
- Derived from:
- ccsbBroadEn_12692
- DNA Barcode:
- CTTGCGGGTGCGAGCAGGAATTAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CPEB4 (80315)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491501
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 80315 | CPEB4 | cytoplasmic polyadenylation... | NM_001308193.1 | 100% | 100% | |
2 | human | 80315 | CPEB4 | cytoplasmic polyadenylation... | NM_001308192.1 | 94.9% | 94.9% | 61_111del |
3 | human | 132864 | CPEB2 | cytoplasmic polyadenylation... | XM_017007733.1 | 54.8% | 63% | (many diffs) |
4 | human | 132864 | CPEB2 | cytoplasmic polyadenylation... | XM_017007734.2 | 54.8% | 63% | (many diffs) |
5 | human | 80315 | CPEB4 | cytoplasmic polyadenylation... | NM_001308191.2 | 45.7% | 45.7% | 1_1146del |
6 | human | 80315 | CPEB4 | cytoplasmic polyadenylation... | NM_001308189.2 | 45.2% | 45.2% | 1_1146del;1206_1229del |
7 | human | 80315 | CPEB4 | cytoplasmic polyadenylation... | XM_005265994.1 | 44.6% | 44.6% | 1_1146del;1207_1257del |
8 | human | 80315 | CPEB4 | cytoplasmic polyadenylation... | NM_030627.4 | 44.1% | 44.1% | 1_1146del;1206_1280del |
9 | human | 22849 | CPEB3 | cytoplasmic polyadenylation... | XM_011539515.2 | 37.1% | 41.4% | (many diffs) |
10 | human | 132864 | CPEB2 | cytoplasmic polyadenylation... | NM_182646.3 | 25.6% | 29.3% | (many diffs) |
11 | human | 132864 | CPEB2 | cytoplasmic polyadenylation... | NM_001177384.2 | 25.6% | 29.2% | (many diffs) |
12 | human | 132864 | CPEB2 | cytoplasmic polyadenylation... | NM_001177383.2 | 25.4% | 29.1% | (many diffs) |
13 | human | 132864 | CPEB2 | cytoplasmic polyadenylation... | NM_001177381.2 | 25.3% | 29% | (many diffs) |
14 | human | 132864 | CPEB2 | cytoplasmic polyadenylation... | NM_182485.3 | 24.9% | 28.5% | (many diffs) |
15 | human | 132864 | CPEB2 | cytoplasmic polyadenylation... | XM_011513777.3 | 24.8% | 28.4% | (many diffs) |
16 | human | 132864 | CPEB2 | cytoplasmic polyadenylation... | NM_001177382.2 | 24.7% | 28.2% | (many diffs) |
17 | human | 132864 | CPEB2 | cytoplasmic polyadenylation... | XM_005248135.3 | 24.6% | 28.2% | (many diffs) |
18 | mouse | 67579 | Cpeb4 | cytoplasmic polyadenylation... | NM_001290678.1 | 42.9% | 45.4% | (many diffs) |
19 | mouse | 67579 | Cpeb4 | cytoplasmic polyadenylation... | XM_006514793.1 | 42.5% | 44.9% | (many diffs) |
20 | mouse | 67579 | Cpeb4 | cytoplasmic polyadenylation... | NM_001290676.1 | 41.9% | 44.3% | (many diffs) |
21 | mouse | 67579 | Cpeb4 | cytoplasmic polyadenylation... | NM_026252.4 | 41.5% | 43.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1032
- ORF length:
- 966
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ctcactggag agttcactca ttgacataat gagagctgaa aatgatacca 121 ttaaaggtca gtcttcactg tttccaatgg aagatggatt cttggatgat ggccgtgggg 181 atcagcctct tcatagtggc ctgggttcac ctcactgctt cagtcaccag aatggggaaa 241 gagtggaacg atattctcga aaggtgtttg taggcggatt gcctccagac attgatgaag 301 atgagatcac agctagtttt cgtcgctttg gccctctgat tgtggattgg cctcataaag 361 ctgagagcaa atcctatttt cctcctaaag gctatgcatt cctgctgttt caagatgaaa 421 gctctgtgca ggctctcatt gatgcatgca ttgaagaaga tggaaaactc tacctttgtg 481 tatcaagtcc cactatcaag gataagccag tccagattcg gccttggaat ctcagtgaca 541 gtgactttgt gatggatggt tcacagccac ttgacccacg aaaaactata tttgttggtg 601 gtgttcctcg accattacga gctgtggagc ttgcgatgat aatggatcgg ctatatggag 661 gtgtgtgcta cgctgggatt gataccgacc cTGAGCTAAA ATACCCAAAA GGAGCTGGGA 721 GAGTTGCGTT CTCTAATCAA CAGAGTTACA TAGCTGCTAT CAGTGCCCGC TTTGTTCAGC 781 TGCAGCATGG AGAGATAGAT AAACGGGTGG AAGTTAAGCC ATATGTCTTG GATGATCAGC 841 TGTGTGATGA ATGTCAGGGG GCCCGTTGTG GGGGGAAATT TGCTCCATTT TTCTGTGCTA 901 ATGTTACCTG TCTGCAGTAT TACTGTGAAT ATTGCTGGGC TGCTATCCAT TCTCGTGCTG 961 GCAGGGAATT CCACAAGCCC CTGGTGAAGG AAGGCGGTGA CCGCCCTCGG CATATTTCAT 1021 TCCGCTGGAA CTACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1081 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1141 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACTT GCGGGTGCGA GCAGGAATTA 1201 GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t