Transcript: Human XM_011514925.3

PREDICTED: Homo sapiens collagen type XXI alpha 1 chain (COL21A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL21A1 (81578)
Length:
4287
CDS:
347..3220

Additional Resources:

NCBI RefSeq record:
XM_011514925.3
NBCI Gene record:
COL21A1 (81578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514925.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371869 TCGTACTGCTCCGACAGATTT pLKO_005 439 CDS 100% 13.200 18.480 N COL21A1 n/a
2 TRCN0000116899 CCTCAAGTTAAGACGTTGTTT pLKO.1 1361 CDS 100% 5.625 7.875 N COL21A1 n/a
3 TRCN0000116898 CCCTCAAGTTAAGACGTTGTT pLKO.1 1360 CDS 100% 4.950 6.930 N COL21A1 n/a
4 TRCN0000371868 ACATGGAAAGGATGGATTAAT pLKO_005 2065 CDS 100% 15.000 10.500 N COL21A1 n/a
5 TRCN0000371870 TTACAACAACCAGCGTAATTA pLKO_005 1311 CDS 100% 15.000 10.500 N COL21A1 n/a
6 TRCN0000116897 CCCTTGGATTAGCAGCATTAA pLKO.1 3411 3UTR 100% 13.200 9.240 N COL21A1 n/a
7 TRCN0000116901 CCTGGTTTAATGGGAAGCAAT pLKO.1 2255 CDS 100% 4.950 3.465 N COL21A1 n/a
8 TRCN0000116900 GCCTTCGTCTACTTATGTGTT pLKO.1 901 CDS 100% 4.950 3.465 N COL21A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514925.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09074 pDONR223 100% 99.9% 100% None 438A>G n/a
2 ccsbBroad304_09074 pLX_304 0% 99.9% 100% V5 438A>G n/a
3 ccsbBroadEn_12722 pDONR223 100% 50% 49.8% None (many diffs) n/a
4 ccsbBroad304_12722 pLX_304 0% 50% 49.8% V5 (many diffs) n/a
5 TRCN0000477491 TAGCCATCCGACGGCTTTCAGCGT pLX_317 5.2% 50% 49.8% V5 (many diffs) n/a
Download CSV