Transcript: Human XM_011516190.2

PREDICTED: Homo sapiens tripartite motif containing 74 (TRIM74), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM74 (378108)
Length:
791
CDS:
82..768

Additional Resources:

NCBI RefSeq record:
XM_011516190.2
NBCI Gene record:
TRIM74 (378108)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221031 GTGCTGGAACAGTTCGGAAAT pLKO.1 601 CDS 100% 10.800 6.480 N TRIM74 n/a
2 TRCN0000437707 AGAAGGACCAGGAGCTCATCT pLKO_005 221 CDS 100% 4.950 2.475 Y TRIM74 n/a
3 TRCN0000221029 CCATGAGTTCATCTGGAAGTT pLKO.1 630 CDS 100% 4.950 2.475 Y TRIM74 n/a
4 TRCN0000221030 CGTCAATGAGTCGGATGTCTT pLKO.1 411 CDS 100% 4.950 2.475 Y TRIM74 n/a
5 TRCN0000221033 CTCATCGCCAAACTGGTGAAA pLKO.1 376 CDS 100% 4.950 2.475 Y TRIM74 n/a
6 TRCN0000447198 ATCGTCAATGAGTCGGATGTC pLKO_005 409 CDS 100% 4.050 2.025 Y TRIM73 n/a
7 TRCN0000180127 CATCTGGAAGTTCCACTCCAT pLKO.1 639 CDS 100% 2.640 1.320 Y TRIM73 n/a
8 TRCN0000180153 CCACCATGAGTTCATCTGGAA pLKO.1 627 CDS 100% 2.640 1.320 Y TRIM73 n/a
9 TRCN0000007785 CGAATCGTCAATGAGTCGGAT pLKO.1 406 CDS 100% 2.640 1.320 Y TRIM50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13639 pDONR223 100% 68.5% 68% None (many diffs) n/a
2 ccsbBroad304_13639 pLX_304 0% 68.5% 68% V5 (many diffs) n/a
3 TRCN0000481047 GACCCCCTCAGCAAATCTAACTCG pLX_317 55.8% 68.5% 68% V5 (many diffs) n/a
4 ccsbBroadEn_09564 pDONR223 100% 44.2% 39.2% None (many diffs) n/a
5 ccsbBroad304_09564 pLX_304 0% 44.2% 39.2% V5 (many diffs) n/a
6 TRCN0000476413 GCAGATCCGACACGTTAAGGCGTT pLX_317 20.6% 44.2% 39.2% V5 (many diffs) n/a
Download CSV